CLTA
Description
clathrin light chain A
Also known as
LCA
Species
Homo sapiens
Entrez ID
1211
MGC ID
BC009201, BC019287
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene, or a homologous gene.
ID | Plasmid | Gene/Insert | PI |
---|---|---|---|
20921 | EYFP-Clathrin | Clathrin, light polypeptide (Lca) (Mus musculus) | Zhuang |
21741 | Clathrin-LCa-EYFP | Clathrin, light polypeptide (LCa) (Mus musculus) | Zhuang |
21742 | Clathrin-LCa-ECFP | Clathrin, light polypeptide (LCa) (Mus musculus) | Zhuang |
27680 | CLC-pmCherryC1 | Clathrin Light Chain (Mus musculus) | Merrifield |
38009 | ptdEos-CLC | Clathrin, light polypeptide (LCa) (Mus musculus), Eos FP, tandem dimer | Zhuang |
38010 | pCLC-mEos2 | Clathrin, light polypeptide (LCa) (Mus musculus) | Zhuang |
38011 | pSNAP-CLC-EYFP | Clathrin, light polypeptide (LCa) (Mus musculus) | Zhuang |
38012 | pSNAP-CLC-SNAP | Clathrin, light polypeptide (LCa) (Mus musculus) | Zhuang |
40271 | prLCA-Citrine | Clta (Rattus norvegicus) | Offterdinger |
59353 | GFP-FKBP-LCa | Clathrin Light Chain A (Homo sapiens) | Royle |
70217 | pEGFP-GFP11-Clathrin light chain | GFP11-Clathrin light chain (Homo sapiens) | Huang |
83032 | pEGFP_sfCherry2(11)_Clathrin light chain | sfCherry2(11)_Clathrin light chain (Homo sapiens) | Huang |
109585 | p3E-Clta | Clathrin light chain a (Danio rerio) | Parton |
112016 | CLTA-GFP HDRT Source (pTR 153) | CLTA-GFP HDRT (Homo sapiens) | Marson |
112017 | CLTA-mCherry HDRT Source (pTR 177) | CLTA-mCherry HDRT (Homo sapiens) | Marson |
131483 | pORANGE GFP-Clta KI | gRNA and GFP donor (Rattus norvegicus) | MacGillavry |
170858 | His-GFP-Clathrin | Clathrin light polypeptide (Lca) (Mus musculus) | Taraska |
186128 | pTR-177 pUC19-CLTA-N-mCherry | CLTA (Homo sapiens) | Marson |
193552 | EGFP-ShadowY-CLC | Clathrin light chain A (Mus musculus) | Taraska |
217345 | gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1) | crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) | Gilbert |