Gata1
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids Related To This Gene
| ID | Plasmid | Gene/Insert | PI |
|---|---|---|---|
| 13626 | pMT2 GATA1 | GATA1 (Mus musculus) | Anjana Rao |
| 41085 | FUW-TetO-Gata1 | Gata1 (Mus musculus) | Rudolf Jaenisch |
| 85693 | pcDNA3 GATA1 | GATA1 (Mus musculus) | Giannino Del Sal |
| 85694 | pcDNA3 GATA1 K137R | GATA1 (Mus musculus) | Giannino Del Sal |
| 181976 | pLeGO.sgGata1.4.RUNX1A.iG2 | GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) | Jan-Henning Klusmann |