Skip to main content

Gata1


Description GATA binding protein 1
Also known as Gata-1, Gf-1, eryf1
Species Mus musculus
Entrez ID 14460

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene

ID Plasmid Gene/Insert PI
13626pMT2 GATA1GATA1 (Mus musculus) Rao
41085FUW-TetO-Gata1Gata1 (Mus musculus) Jaenisch
85693pcDNA3 GATA1GATA1 (Mus musculus) Del Sal
85694pcDNA3 GATA1 K137R GATA1 (Mus musculus) Del Sal
181976pLeGO.sgGata1.4.RUNX1A.iG2GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) Klusmann