Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
133868 pJFRC-nSyb-IVS-PhiC31 PhiC31 Recombinase Clandinin Jan 21, 2020
135231 pBIP1::eYFP pBiP1 (Arabidopsis thaliana) Djamei Jan 21, 2020
133990 pHP025Env Envelope Glycoprotein Garg Jan 21, 2020
134775 pCX-SponGee SponGee (Synthetic) Nicol Jan 21, 2020
134776 pCX-Lyn-SponGee Lyn-SponGee (Synthetic) Nicol Jan 21, 2020
134777 pCX-SponGee-Kras SponGee-Kras (Synthetic) Nicol Jan 21, 2020
134778 pCX-ThPDE5VV ThPDE5VV (Synthetic) Nicol Jan 21, 2020
134836 IF189 lysogen of a temperature-inducible bacteriophage lambda Finkelstein Jan 21, 2020
133397 BII-ChPtW-iRFP670 iRFP-670-NLS (Other) Madison Jan 21, 2020
133358 BII-gR-BtW-eSpCas9 eSpCas9 (Other) Madison Jan 21, 2020
129226 pGEX-4T-1-3xHA-IκBα(1-62) IkBa(1-62) (Homo sapiens) Janes Jan 21, 2020
129227 pET-29b-3xGluGlu-c-jun-His6 cJun (Homo sapiens) Janes Jan 21, 2020
129228 pGEX-4T-1-3xMyc-ERK2(K52R) ERK2(K52R) (Rattus norvegicus) Janes Jan 21, 2020
129229 pGEX-4T-1-3xFLAG-HSP27 HSP27 (Homo sapiens) Janes Jan 21, 2020
129567 pGEX-4T-1-3xHA Janes Jan 21, 2020
129568 pGEX-4T-1-3xVSVG Janes Jan 21, 2020
129569 pGEX-4T-1-3xMyc Janes Jan 21, 2020
129570 pGEX-4T-1-3xFLAG Janes Jan 21, 2020
129571 pGEX-4T-1-3xGluGlu Janes Jan 21, 2020
129572 pGEX-4T-1-3xAU1 Janes Jan 21, 2020
129582 pGEX-4T-1-3xVSVG-GSK3(1-97) GSK3a(1-97) (Homo sapiens) Janes Jan 21, 2020
129583 pET-29b-3xVSVG-GSK3(1-97) GSK3a(1-97) (Homo sapiens) Janes Jan 21, 2020
99651 pAAV-dSa-VPR dCas9 (Synthetic) Church Jan 21, 2020
50457-AAV2 pAAV-hSyn-DIO-EGFP (AAV2) Roth Jan 17, 2020
112677-AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2) Harvey Jan 17, 2020
134405 pBbAW4k-loxP-TT-loxP-mRFP1 W4-loxP-TT-loxP-mRFP1 Dunlop Jan 17, 2020
134404 pBbE5a-Opto-Cre-Vvd Opto-Cre-Vvd Dunlop Jan 17, 2020
128386 pLenti NLuc398-G8NCRD IRES G8NCRD-CLuc394 NLuc-3xGGGGS-Gal8-NCRD (Homo sapiens), Gal8-NCRD-3xGGGGS-CLuc398 (Homo sapiens) Duvall Jan 17, 2020
128387 pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394 NLuc398-3xGGGGS-LGALS8 (Homo sapiens), CALCOCO2-3xGGGGS-CLuc394 (Homo sapiens) Duvall Jan 17, 2020
136623 pCDNA3.0_mitoSNAP NTOM20-SNAP-Tag (Synthetic) Johnsson Jan 16, 2020
132530 DYNLL1 DYNLL1 (Homo sapiens) Carter Jan 16, 2020
133386 BII-C3H Madison Jan 16, 2020
121922 pAAV-hSyn-GRAB_ACh3.0 GPCR activation based ACh sensor GRAB-ACh3.0 (Homo sapiens) Li Jan 16, 2020
121923 pAAV-hSyn-DIO-GRAB_ACh3.0 GPCR activation based ACh sensor GRAB-ACh3.0 (Homo sapiens) Li Jan 16, 2020
135267 p663-UBC-TurboID-V5-CDK13_IDG-K TurboID-V5-CDK13 (Homo sapiens) Major Jan 16, 2020
135248 p667-UBC-PKMYT1-V5_IDG-K PKMYT1-V5 (Homo sapiens) Major Jan 16, 2020
135268 p663-UBC-V5-CDK13_IDG-K V5-CDK13 (Homo sapiens) Major Jan 16, 2020
136244 pMal-EcPhr EcPhr (Other) Sancar Jan 16, 2020
136246 pcDNA4-Claspin-Flag Claspin (Homo sapiens) Sancar Jan 16, 2020
136242 pcDNA4-ZfCry4 ZfCry4 (Danio rerio) Sancar Jan 16, 2020
119281 BRCA1-plvxt BRCA1 (Homo sapiens) Massague Jan 16, 2020
119282 ID1GFP Donor Id1GFP + homology arms (Mus musculus) Massague Jan 16, 2020
119280 ID1-pLVXT Id1 (Mus musculus) Massague Jan 16, 2020
99694 pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2 dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) Church Jan 16, 2020
122880 pICE MET17 Hampton Jan 16, 2020
135252 p667-UBC-BRSK2-V5-miniTurbo_IDG-K BRSK2-V5-miniTurbo (Homo sapiens) Major Jan 15, 2020
135250 p667-UBC-TLK2-V5-TurboID_IDG-K TLK2-V5-TurboID (Homo sapiens) Major Jan 15, 2020
135273 p663-UBC-V5-BRSK2_IDG-K V5-BRSK2 (Homo sapiens) Major Jan 15, 2020
135239 p667-UBC-hcRed-V5_IDG-K hcRed-V5 (Other) Major Jan 15, 2020
135272 p663-UBC-TurboID-V5-BRSK2_IDG-K TurboID-V5-BRSK2 (Homo sapiens) Major Jan 15, 2020