Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR FGFR1-CD3ε-FusionRed
(Plasmid #188632)


Item Catalog # Description Quantity Price (USD)
Plasmid 188632 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Promoter SFFV
  • Tag / Fusion Protein
    • CD3ε-FusionRed (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccgacagactgagtcgcccggg
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR FGFR1-CD3ε-FusionRed was a gift from Jared Toettcher (Addgene plasmid # 188632 ; ; RRID:Addgene_188632)
  • For your References section:

    pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. Farahani PE, Yang X, Mesev E, Fomby K, Bashor C, Nelson CM, Toettcher JE. bioRxiv (2022) 10.1101/2022.08.13.503850