Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
236396 pcDNA3.1(+)-FLAG-Rgs14 Rattus norvegicus regulator of G-protein signaling 14 (Rattus norvegicus) Hepler May 01, 2025
234521 pUASTattB-cytoFLARE1.0-TF ERT2-MK2-hLOV-TEVcs-FLAG-LexA-VP16 (Drosophila melanogaster) Wang May 01, 2025
234519 pUASTattB-cytoFLARE1.0-TEV CaM-V5-TEVp (Drosophila melanogaster) Wang May 01, 2025
235681 pCW-TAZ-CAMTA1 TAZ-CAMTA1 (Homo sapiens) Pan May 01, 2025
221060 H75R SUMO1 H75R site mutation on SUMO 1 (Homo sapiens) Rosen May 01, 2025
232733 pUC19_CDC45_dTAG CDC45 (Homo sapiens) Chen May 01, 2025
235502 pBS AID-3xF_PP Auxin Inducible Degron (Arabidopsis thaliana) Hendrich May 01, 2025
235176 pcDNA3.1 NPY pHLeon NPY-pHLeon (Homo sapiens) White May 01, 2025
235175 pcDNA3.1 NPY pHCitron NPY-pHCitron (Homo sapiens) White May 01, 2025
236225 pOET3-6xHis-hSMSr-ΔSAMD SAMD8 (Homo sapiens) Murakami May 01, 2025
236224 pOET3-6xHis-hSMSr SAMD8 (Homo sapiens) Murakami May 01, 2025
234543 pAAV-P3-IgKL-SpyCatcher003-mNeonGreen IgKL-SpyCatcher003-mNeonGreen (Other) Hirase Apr 30, 2025
234541 pAAV-P3-IgKL-SpyCatcher003-SEP IgKL-SpyCatcher003-SEP (Other) Hirase Apr 30, 2025
207605 Halo XLF sgRNA GTTCTTCCATctgcaaaaaa (Homo sapiens) Schmidt Apr 30, 2025
235499 pEGFP-TDP-43 (4SA) TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
230654 AiP1431 - pAAV-AiE2142m-minBG-SYFP2-WPRE3-BGHpA SYFP2 (Synthetic) Tasic Apr 30, 2025
235500 pENTR-TDP-43-SUMO2-HA TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
230650 AiP1423 - pAAV-AiE2130m-minBG-SYFP2-WPRE3-BGHpA SYFP2 (Synthetic) Tasic Apr 30, 2025
207606 HaloXRCC4 sgRNA TACTGGGTTCAGAAACAAGG (Homo sapiens) Schmidt Apr 30, 2025
235501 pENTR-TDP-43-HA TARDBP (Homo sapiens) Rousseaux Apr 30, 2025
235497 pL302-HA-SUMO2 SUMO2 (Homo sapiens) Rousseaux Apr 30, 2025
235498 pLV-Hspa1l-mRuby2 Hspa1l (Mus musculus) Rousseaux Apr 30, 2025
230472 AiP14128 - pAAV-AiE0354h-minBG-iCre-WPRE3-BGHpA (Alias: CN4128) iCre (Synthetic) Ting Apr 30, 2025
230471 AiP13908 - pAAV-AiE0440h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3908) SYFP2 (Synthetic) Ting Apr 30, 2025
230470 AiP13903 - pAAV-AiE0710m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3903) SYFP2 (Synthetic) Ting Apr 30, 2025
230466 AiP13605 - pAAV-AiE0682h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3605) SYFP2 (Synthetic) Ting Apr 30, 2025
230465 AiP13604 - pAAV-AiE0682h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3604) SYFP2 (Synthetic) Ting Apr 30, 2025
230464 AiP13603 - pAAV-AiE0600m_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3603) SYFP2 (Synthetic) Ting Apr 30, 2025
230463 AiP13601 - pAAV-AiE0600m_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3601) SYFP2 (Synthetic) Ting Apr 30, 2025
230462 AiP13598 - pAAV-AiE0528h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3598) SYFP2 (Synthetic) Ting Apr 30, 2025
230461 AiP13589 - pAAV-AiE0512h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3589) SYFP2 (Synthetic) Ting Apr 30, 2025
230458 AiP13564 - pAAV-AiE0170h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3564) SYFP2 (Synthetic) Ting Apr 30, 2025
230457 AiP13562 - pAAV-AiE0170h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3562) SYFP2 (Synthetic) Ting Apr 30, 2025
230456 AiP13561 - pAAV-AiE0077h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3561) SYFP2 (Synthetic) Ting Apr 30, 2025
230455 AiP13559 - pAAV-AiE0077h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3559) SYFP2 (Synthetic) Ting Apr 30, 2025
230454 AiP13555 - pAAV-AiE0017h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3555) SYFP2 (Synthetic) Ting Apr 30, 2025
230453 AiP13553 - pAAV-AiE0017h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3553) SYFP2 (Synthetic) Ting Apr 30, 2025
230452 AiP13551 - pAAV-AiE0017m_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3551) SYFP2 (Synthetic) Ting Apr 30, 2025
230433 AiP11922 - pAAV-3xSP10ins-AiE0310m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1922) SYFP2 (Synthetic) Ting Apr 30, 2025
230432 AiP11919 - pAAV-3xSP10ins-AiE0300m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1919) SYFP2 (Synthetic) Ting Apr 30, 2025
230430 AiP11772 - pAAV-hsA2-AiE0254h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1772) SYFP2 (Synthetic) Ting Apr 30, 2025
230429 AiP11719 - pAAV-hsA2-AiE0226h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1719) SYFP2 (Synthetic) Ting Apr 30, 2025
230427 AiP11687 - pAAV-hsA2-AiE0194h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1687) SYFP2 (Synthetic) Ting Apr 30, 2025
230424 AiP11623 - pAAV-hsA2-AiE0130h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1623) SYFP2 (Synthetic) Ting Apr 30, 2025
230423 AiP11615 - pAAV-hsA2-AiE0121m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1615) SYFP2 (Synthetic) Ting Apr 30, 2025
230421 AiP11591 - pAAV-hsA2-AiE0097m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1591) SYFP2 (Synthetic) Ting Apr 30, 2025
230420 AiP11590 - pAAV-hsA2-AiE0096m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1590) SYFP2 (Synthetic) Ting Apr 30, 2025
230419 AiP11583 - pAAV-hsA2-AiE0089m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1583) SYFP2 (Synthetic) Ting Apr 30, 2025
230418 AiP11574 - pAAV-hsA2-AiE0080m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1574) SYFP2 (Synthetic) Ting Apr 30, 2025
230415 AiP11535 - pAAV-hsA2-AiE0089h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1535) SYFP2 (Synthetic) Ting Apr 30, 2025