|
|
230196 |
AiP12260 - pAAV-AiE0485m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2260) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230195 |
AiP12259 - pAAV-AiE0480m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2259) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230193 |
AiP12167 - pAAV-AiE0407h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2167) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230192 |
AiP12164 - pAAV-AiE0404h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2164) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230191 |
AiP12160 - pAAV-AiE0398h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2160) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230190 |
AiP12159 - pAAV-AiE0397h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2159) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230189 |
AiP12152 - pAAV-AiE0389h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2152) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230188 |
AiP12120 - pAAV-AiE0376m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2120) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230186 |
AiP12092 - pAAV-AiE0402m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2092) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230185 |
AiP12091 - pAAV-AiE0398m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2091) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230184 |
AiP12083 - pAAV-AiE0372m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2083) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
235493 |
pEGFP-TDP-43 (K408R) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235488 |
pEGFP-TDP-43 (Q331K) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235491 |
pEGFP-TDP-43 (5FL) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230639 |
AiP1390 - pAAV-AiE2161m-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
235487 |
pEGFP-TDP-43 |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235492 |
pEGFP-TDP-43 (K136R) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230623 |
AiP1327 - pAAV-AiE2068m_3xC2-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
207583 |
HaloKu70 sgRNA |
GAGCAGTAGCCAACATGTCA (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235496 |
pDEST-TDP-43-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
207093 |
DNA-PKcs N-terminal sgRNA |
AGCGGGACTCGGCGGCATGG (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235495 |
pDEST-TDP-43-SUMO2-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
207088 |
Halo-DNAPKcs HRD |
HaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
214429 |
pLEX_307-SARS-CoV-2-NSP3-V5 |
SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab) (Other)
|
Babu |
Apr 30, 2025 |
|
|
191224 |
pLD-puro-Cc-IFIT5_K206R-VA |
interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens)
|
Babu |
Apr 30, 2025 |
|
|
191223 |
pLD-puro-Cc-IFIT5_K197R-VA |
interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens)
|
Babu |
Apr 30, 2025 |
|
|
191222 |
pLD-puro-Cc-IFIT5_K160R-VA |
interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens)
|
Babu |
Apr 30, 2025 |
|
|
191221 |
pLD-puro-Cc-IFIT5_WT-VA |
interferon-induced protein with tetratricopeptide repeats 5 (Homo sapiens)
|
Babu |
Apr 30, 2025 |
|
|
191220 |
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA |
SPIKE_SARS2_Lambda (Other)
|
Babu |
Apr 30, 2025 |
|
|
191219 |
pLD-puro-Cc-SARS-CoV-2_Spike_Delta-VA |
SPIKE_SARS2_Delta (Other)
|
Babu |
Apr 30, 2025 |
|
|
191218 |
pLD-puro-Cc-SARS-CoV-2_Spike_Beta-VA |
SPIKE_SARS2_Beta (Other)
|
Babu |
Apr 30, 2025 |
|
|
191217 |
pLD-puro-Cc-SARS-CoV-2_Spike_Alpha-VA |
SPIKE_SARS2_Alpha (Other)
|
Babu |
Apr 30, 2025 |
|
|
191216 |
pLD-puro-Cc-SARS-CoV-2_Spike_WT-VA |
SPIKE_SARS2_WT (Other)
|
Babu |
Apr 30, 2025 |
|
|
191215 |
pLD-puro-Cc-SARS-CoV-2_NSP16-VA |
Non structural protein 16 (Other)
|
Babu |
Apr 30, 2025 |
|
|
191214 |
pLD-puro-Cc-SARS-CoV-2_NSP3-VA |
Non structural protein 3 (Other)
|
Babu |
Apr 30, 2025 |
|
|
191212 |
pcDNA3.1-SARS2-Spike-HiBiT |
SARS-CoV-2 spike_WT (Other)
|
Babu |
Apr 30, 2025 |
|
|
191211 |
pLEX-307_LgBiT |
LgBiT (large bit) (Other)
|
Babu |
Apr 30, 2025 |
|
|
207550 |
AAVS1 EGFP-p62 HRD |
TET inducible EGFP-P62 (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
223662 |
pAAV-hSyn-DIO-mCherry-CW3SL |
mCherry
|
Marin |
Apr 30, 2025 |
|
|
223661 |
pAAV-hSyn-DIO-Vgf-T2A-mCherry-CW3SL |
Vgf-T2A-mCherry (Mus musculus)
|
Marin |
Apr 30, 2025 |
|
|
223660 |
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shLacZ-CWB |
hM3D(Gq)-mCherry and shLacZ (Homo sapiens)
|
Marin |
Apr 30, 2025 |
|
|
223659 |
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shScg2-CWB |
hM3D(Gq)-mCherry and shScg2 (Homo sapiens)
|
Marin |
Apr 30, 2025 |
|
|
223658 |
pAAV-hSyn-DIO-hM3D(Gq)-mCherry-shVgf-CWB |
hM3D(Gq)-mCherry and shVGF (Homo sapiens)
|
Marin |
Apr 30, 2025 |
|
|
223654 |
pAAV-hSyn-flx-fDIO-HA-Rpl10a-T2A-myc-hM3D(Gq) |
vTRAP-T2A-hM3D(Gq) (Homo sapiens)
|
Marin |
Apr 30, 2025 |
|
|
223652 |
pAAV-hSyn-fDIO-hM3D(Gq)-mCherry |
hM3D(Gq)-mCherry (Homo sapiens)
|
Marin |
Apr 30, 2025 |
|
|
235591 |
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut |
Dot1l (Mus musculus)
|
Hackett |
Apr 30, 2025 |
|
|
235590 |
pPB_TRE3G_scFV-sfGFP-Kmt5cFL-CatMut |
Kmt5c (Mus musculus)
|
Hackett |
Apr 30, 2025 |
|
|
230622 |
AiP1326 - pAAV-AiE2057m_3xC2-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
227087 |
CPH3737_GST-TEV-Spt6p-tSH2-1223-1453 |
spt6-tsh2 (Saccharomyces cerevisiae)
|
Hill |
Apr 30, 2025 |
|
|
235588 |
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut |
Setd2 (Mus musculus)
|
Hackett |
Apr 30, 2025 |
