|
|
232584 |
pEHAC1-HA-BirAonly |
BirA (Other)
|
Bhogaraju |
Mar 11, 2025 |
|
|
232119 |
pET28 MBP-TEV-Rat BCKDK-His |
BCKDK (Rattus norvegicus)
|
Sommese |
Mar 11, 2025 |
|
|
234456 |
pEN019-SpCas9-hiNLS-t-M1M4 |
SpCas9 hiNLS t-M1M4 (Other)
|
Wilson |
Mar 11, 2025 |
|
|
234455 |
pEN017-SpCas9-hiNLS-t-M4 |
SpCas9 hiNLS t-M4 (Other)
|
Wilson |
Mar 11, 2025 |
|
|
233887 |
His-GST-TEV-BRD4(42-459) BD1-BD2 |
BRD4 (Homo sapiens)
|
Ciulli |
Mar 11, 2025 |
|
|
233687 |
BIC-Gag-DDX3 |
DEAD-box helicase 3 (Homo sapiens)
|
Ricci |
Mar 11, 2025 |
|
|
233625 |
psiCHECK2-7xCGCGCG |
7xCGCGCG (Synthetic)
|
Iwasaki |
Mar 11, 2025 |
|
|
233615 |
psiCHECK2-1_Rluc-Y39x-Fluc |
Rluc-Y39x-Fluc (Synthetic)
|
Iwasaki |
Mar 11, 2025 |
|
|
233613 |
pC016-gPsp-EGFP_start_codon |
gRNA targeting EGFP (Synthetic)
|
Iwasaki |
Mar 11, 2025 |
|
|
234120 |
pRS424 Prp8 WT TRP1 |
Prp8 (Saccharomyces cerevisiae)
|
Hoskins |
Mar 11, 2025 |
|
|
233132 |
cASIC1 concatemer - vector backbone |
|
MacLean |
Mar 11, 2025 |
|
|
233738 |
HIS-HA-CMYC P53 |
HIS-HA-CMYC-p53 (Homo sapiens)
|
Keung |
Mar 11, 2025 |
|
|
232581 |
pcDNA5-AP-Ub-dGG |
Ubiquitin (Homo sapiens)
|
Bhogaraju |
Mar 11, 2025 |
|
|
232583 |
pcDNA5-AP(-3)-Ub |
Ubiquitin (Homo sapiens)
|
Bhogaraju |
Mar 11, 2025 |
|
|
233262 |
HemH-R212A_pET-14b |
HemH
|
Babu |
Mar 11, 2025 |
|
|
232577 |
pcDNA5-AP-Ub |
Ubiquitin (Homo sapiens)
|
Bhogaraju |
Mar 11, 2025 |
|
|
234361 |
pCR4_miniFXN_8 |
FXN (Homo sapiens)
|
Napierala |
Mar 11, 2025 |
|
|
234360 |
pCR4_miniFXN_7 |
FXN (Homo sapiens)
|
Napierala |
Mar 11, 2025 |
|
|
233623 |
psiCHECK2-7xUCUCUC |
7xUCUCUC (Synthetic)
|
Iwasaki |
Mar 11, 2025 |
|
|
233621 |
pColdI-SBP-eIF4A1 |
SBP-eIF4A1 (Homo sapiens)
|
Iwasaki |
Mar 11, 2025 |
|
|
233620 |
pColdI-DDX3_helicase_core_Q360P |
DDX3X helicase core Gln360Pro (Homo sapiens)
|
Iwasaki |
Mar 11, 2025 |
|
|
233619 |
pColdI-DDX3_helicase_core_Q360L |
DDX3X helicase core Gln360Leu (Homo sapiens)
|
Iwasaki |
Mar 11, 2025 |
|
|
233629 |
psiCHECK2-Eef2TOPm-RLCP-HCVIRES-FL |
Promoter and 5'UTR of Eef2 gene with mutation in TOP motif and HCV IRES (Mus musculus)
|
Iwasaki |
Mar 11, 2025 |
|
|
233628 |
psiCHECK2-Eef2TOP-RLCP-HCVIRES-FL |
Promoter and 5'UTR of Eef2 gene and HCV IRES (Mus musculus)
|
Iwasaki |
Mar 11, 2025 |
|
|
233624 |
psiCHECK2-7xUGUGUG |
7xUGUGUG (Synthetic)
|
Iwasaki |
Mar 11, 2025 |
|
|
233618 |
pColdI-DDX3_helicase_core |
DDX3X helicase core WT (Homo sapiens)
|
Iwasaki |
Mar 11, 2025 |
|
|
232888 |
pML107-ARB1 |
ARB1 gRNA (Saccharomyces cerevisiae)
|
Van Leeuwen |
Mar 11, 2025 |
|
|
232587 |
pEHAC1-CHIP-BirA-HA |
CHIP - BirA (Homo sapiens)
|
Bhogaraju |
Mar 11, 2025 |
|
|
232588 |
pEHAC1-CHIP-GSGS-BirA-HA |
CHIP - BirA (Homo sapiens)
|
Bhogaraju |
Mar 11, 2025 |
|
|
233217 |
Anti-amyloid-β 40/42 nanobody (R3VQ) with sortase tag |
Anti-amyloid-β 40/42 nanobody (R3VQ) (Other)
|
Lichtman |
Mar 11, 2025 |
|
|
233218 |
Anti-pTau nanobody (A2) with sortase tag |
Anti-pTau nanobody (A2) (Other)
|
Lichtman |
Mar 11, 2025 |
|
|
233257 |
Start Stuffer TurboID V5 T2A BFP |
TurboID V5 T2A BFP (Other)
|
Bryant |
Mar 11, 2025 |
|
|
233248 |
pLentiCRISPR V2 Neo sgAGAP1_3 |
AGAP1 (Mus musculus)
|
Bryant |
Mar 11, 2025 |
|
|
230855 |
pGH912 |
DivA-BE3
|
Hess |
Mar 11, 2025 |
|
|
233256 |
hARF6-R WT TurboID V5 T2A BFP |
ARF6 (Homo sapiens)
|
Bryant |
Mar 11, 2025 |
|
|
233244 |
pLentiCRISPR V2 Neo sgNon-targeting |
non targeting control sgRNA (Other)
|
Bryant |
Mar 11, 2025 |
|
|
233033 |
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa |
DjCas13d and mCherry (Synthetic)
|
Ploski |
Mar 11, 2025 |
|
|
233029 |
pAAV-EFS-hfCas13d-HA-mCherry-pA |
hfCas13d-mCherry (Synthetic)
|
Ploski |
Mar 11, 2025 |
|
|
233245 |
pLentiCRISPR V2 Neo PTEN sgRNA2 |
PTEN (Mus musculus)
|
Bryant |
Mar 11, 2025 |
|
|
233030 |
pAAV-EFS-DjCas13d-HA-mCherry-pA |
DjCas13d-mCherry (Synthetic)
|
Ploski |
Mar 11, 2025 |
|
|
233247 |
pLentiCRISPR V2 Neo sgAGAP1_2 |
AGAP1 (Mus musculus)
|
Bryant |
Mar 11, 2025 |
|
|
233028 |
pAAV-EFS-CasRx-HA-mCherry-pA |
CasRx-mCherry (Synthetic)
|
Ploski |
Mar 11, 2025 |
|
|
1000000253 |
EcoFlex MoClo Extension, Volume I |
|
Shapiro |
Mar 11, 2025 |
|
|
229230 |
pFA6a-FLAG-APEX2-NES-HIS3 |
|
Reggiori |
Mar 11, 2025 |
|
|
228215 |
pET28b-T4Dda |
dda (Other)
|
Benkovic |
Mar 11, 2025 |
|
|
228211 |
pTYB1-T4gp46 |
46 (Other)
|
Benkovic |
Mar 11, 2025 |
|
|
160295 |
pCY5h |
sgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA) (Synthetic), URA3 selection cassette (Saccharomyces cerevisiae), sgRNA expression cassette (without guide) (Synthetic), Cas9 (Other)
|
Aharoni |
Mar 11, 2025 |
|
|
160296 |
pCY5n |
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG) (Synthetic), URA3 selection cassette (Saccharomyces cerevisiae), sgRNA expression cassette (without guide) (Synthetic), Cas9 (Other)
|
Aharoni |
Mar 11, 2025 |
|
|
221127 |
pDP0437 |
pHluorin (Saccharomyces cerevisiae)
|
O’Donnell |
Mar 11, 2025 |
|
|
221125 |
pRS413-TEF1pr-VPH1-FAPoptim |
VPH1-FAPoptim (Saccharomyces cerevisiae)
|
O’Donnell |
Mar 11, 2025 |
