|
|
236395 |
pLIC-His6-MBP-TEV-Rgs14 |
Rattus norvegicus regulator of G-protein signaling 14 (Rattus norvegicus)
|
Hepler |
May 01, 2025 |
|
|
230795 |
AiP20070 - pAAV-AiE2569m-minBG-iCre(R297T)-BGHpA |
iCre(R297T) (Synthetic)
|
Tasic |
May 01, 2025 |
|
|
207079 |
Rev7-Halo HRD |
HaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences (Homo sapiens)
|
Schmidt |
May 01, 2025 |
|
|
230681 |
AiP1636 - pAAV-AiE2116m-minBG-DIO-iCre-WPRE-BGHpA |
iCre (Synthetic)
|
Tasic |
May 01, 2025 |
|
|
230679 |
AiP1634 - pAAV-AiE2114m-minBG-iCre-HGHpA |
iCre (Synthetic)
|
Tasic |
May 01, 2025 |
|
|
236396 |
pcDNA3.1(+)-FLAG-Rgs14 |
Rattus norvegicus regulator of G-protein signaling 14 (Rattus norvegicus)
|
Hepler |
May 01, 2025 |
|
|
234521 |
pUASTattB-cytoFLARE1.0-TF |
ERT2-MK2-hLOV-TEVcs-FLAG-LexA-VP16 (Drosophila melanogaster)
|
Wang |
May 01, 2025 |
|
|
234519 |
pUASTattB-cytoFLARE1.0-TEV |
CaM-V5-TEVp (Drosophila melanogaster)
|
Wang |
May 01, 2025 |
|
|
235681 |
pCW-TAZ-CAMTA1 |
TAZ-CAMTA1 (Homo sapiens)
|
Pan |
May 01, 2025 |
|
|
221060 |
H75R SUMO1 |
H75R site mutation on SUMO 1 (Homo sapiens)
|
Rosen |
May 01, 2025 |
|
|
232733 |
pUC19_CDC45_dTAG |
CDC45 (Homo sapiens)
|
Chen |
May 01, 2025 |
|
|
235502 |
pBS AID-3xF_PP |
Auxin Inducible Degron (Arabidopsis thaliana)
|
Hendrich |
May 01, 2025 |
|
|
235176 |
pcDNA3.1 NPY pHLeon |
NPY-pHLeon (Homo sapiens)
|
White |
May 01, 2025 |
|
|
235175 |
pcDNA3.1 NPY pHCitron |
NPY-pHCitron (Homo sapiens)
|
White |
May 01, 2025 |
|
|
236225 |
pOET3-6xHis-hSMSr-ΔSAMD |
SAMD8 (Homo sapiens)
|
Murakami |
May 01, 2025 |
|
|
236224 |
pOET3-6xHis-hSMSr |
SAMD8 (Homo sapiens)
|
Murakami |
May 01, 2025 |
|
|
234543 |
pAAV-P3-IgKL-SpyCatcher003-mNeonGreen |
IgKL-SpyCatcher003-mNeonGreen (Other)
|
Hirase |
Apr 30, 2025 |
|
|
234541 |
pAAV-P3-IgKL-SpyCatcher003-SEP |
IgKL-SpyCatcher003-SEP (Other)
|
Hirase |
Apr 30, 2025 |
|
|
207605 |
Halo XLF sgRNA |
GTTCTTCCATctgcaaaaaa (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235499 |
pEGFP-TDP-43 (4SA) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230654 |
AiP1431 - pAAV-AiE2142m-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
235500 |
pENTR-TDP-43-SUMO2-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230650 |
AiP1423 - pAAV-AiE2130m-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
207606 |
HaloXRCC4 sgRNA |
TACTGGGTTCAGAAACAAGG (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235501 |
pENTR-TDP-43-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235497 |
pL302-HA-SUMO2 |
SUMO2 (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235498 |
pLV-Hspa1l-mRuby2 |
Hspa1l (Mus musculus)
|
Rousseaux |
Apr 30, 2025 |
|
|
230472 |
AiP14128 - pAAV-AiE0354h-minBG-iCre-WPRE3-BGHpA (Alias: CN4128) |
iCre (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230471 |
AiP13908 - pAAV-AiE0440h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3908) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230470 |
AiP13903 - pAAV-AiE0710m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3903) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230466 |
AiP13605 - pAAV-AiE0682h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3605) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230465 |
AiP13604 - pAAV-AiE0682h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3604) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230464 |
AiP13603 - pAAV-AiE0600m_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3603) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230463 |
AiP13601 - pAAV-AiE0600m_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3601) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230462 |
AiP13598 - pAAV-AiE0528h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3598) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230461 |
AiP13589 - pAAV-AiE0512h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3589) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230458 |
AiP13564 - pAAV-AiE0170h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3564) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230457 |
AiP13562 - pAAV-AiE0170h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3562) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230456 |
AiP13561 - pAAV-AiE0077h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3561) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230455 |
AiP13559 - pAAV-AiE0077h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3559) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230454 |
AiP13555 - pAAV-AiE0017h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3555) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230453 |
AiP13553 - pAAV-AiE0017h_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3553) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230452 |
AiP13551 - pAAV-AiE0017m_3xC1-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3551) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230433 |
AiP11922 - pAAV-3xSP10ins-AiE0310m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1922) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230432 |
AiP11919 - pAAV-3xSP10ins-AiE0300m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1919) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230430 |
AiP11772 - pAAV-hsA2-AiE0254h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1772) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230429 |
AiP11719 - pAAV-hsA2-AiE0226h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1719) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230427 |
AiP11687 - pAAV-hsA2-AiE0194h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1687) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230424 |
AiP11623 - pAAV-hsA2-AiE0130h-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1623) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
|
|
230423 |
AiP11615 - pAAV-hsA2-AiE0121m-minRho-SYFP2-WPRE3-BGHpA (Alias: CN1615) |
SYFP2 (Synthetic)
|
Ting |
Apr 30, 2025 |
