Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
167708 BirA-Myc_N_HEN1 HEN1 (Homo sapiens) Varjosalo Apr 26, 2022
183158 pUC19/Vc-C Zhu Apr 26, 2022
167703 BirA-Myc_N_FOXL1 FOXL1 (Homo sapiens) Varjosalo Apr 26, 2022
176710 pYCTK006 P-SST2 (Saccharomyces cerevisiae) Sourjik Apr 26, 2022
183157 pUC19/N-Vc Zhu Apr 26, 2022
167702 BirA-Myc_N_FOXI1 FOXI1 (Homo sapiens) Varjosalo Apr 26, 2022
183160 pUC19/mChe-C Zhu Apr 26, 2022
183159 pUC19/N-mChe Zhu Apr 26, 2022
167700 BirA-Myc_N_ETS1 ETS1 (Homo sapiens) Varjosalo Apr 26, 2022
183155 pUC19/N-eCFP Zhu Apr 26, 2022
184464 PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (Homo sapiens) Doudna Apr 26, 2022
172092 IMPT-2070 Homo sapiens adenosine A2a receptor (ADORA2A) (Homo sapiens) Stevens Apr 26, 2022
183054 pGL3 RARE-RFP RFP Kalcheim Apr 26, 2022
183055 pGL3 RARE-d2EGFP d2EGFP Kalcheim Apr 26, 2022
182497 pTET GFP10-FRB/FKBP-GFP11 FRB (Homo sapiens), FKBP (Mus musculus) Cabantous Apr 26, 2022
180000 pKB233.3 mNeonGreen (Other) Tabor Apr 26, 2022
181976 pLeGO.sgGata1.4.RUNX1A.iG2 GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) Klusmann Apr 26, 2022
180001 pKB233.4 mNeonGreen (Other) Tabor Apr 26, 2022
181970 pOT_1 - lenti-EFS-LTBR-2A-puro LTBR (Homo sapiens) Sanjana Apr 25, 2022
181971 pOT_2 - lenti-EFS-tNGFR-2A-puro tNGFR (Homo sapiens) Sanjana Apr 25, 2022
181972 pOT_3 - lenti-EFS-FMC6.3-28z-2A-puro-2A-LTBR FMC6.3-28z CAR; LTBR (Homo sapiens) Sanjana Apr 25, 2022
181973 pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR FMC6.3-BBz CAR; LTBR (Homo sapiens) Sanjana Apr 25, 2022
181974 pOT_5 - lenti-EFS-FMC6.3-28z-2A-puro-2A-tNGFR FMC6.3-28z CAR; tNGFR (Homo sapiens) Sanjana Apr 25, 2022
181975 pOT_6 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-tNGFR FMC6.3-BBz CAR; tNGFR (Homo sapiens) Sanjana Apr 25, 2022
179999 pKB233.2 mNeonGreen (Other) Tabor Apr 25, 2022
180608 pJJGL004 PlmCasX with DpbCasX R1 loop (Other) Doudna Apr 25, 2022
180514 pCAT527 CasX sgRNAv2, PlmCasX with DpbCasX R1 loop-2A-mNeonGreen (Other) Doudna Apr 25, 2022
180605 pJJGL001 DpbCasX Doudna Apr 25, 2022
180606 pJJGL002 PlmCasX (Other) Doudna Apr 25, 2022
180607 pJJGL003 DpbCasX with R3 loop Doudna Apr 25, 2022
180510 pCAT105 CasX sgRNAv2, DpbCasX with R3 loop Doudna Apr 25, 2022
180511 pCAT077 CasX sgRNAv2, PlmCasX (Other) Doudna Apr 25, 2022
180512 pCAT100 CasX sgRNAv2, PlmCasX with DpbCasX R1 loop (Other) Doudna Apr 25, 2022
180513 pCAT526 CasX sgRNAv1, PlmCasX-2A-mNeonGreen Doudna Apr 25, 2022
183900 TALED_Right-ND1-AD TALED for ND1 mutation (Synthetic) Kim Apr 25, 2022
183899 TALED_Right-ND1-1397N-UGI DDCBE for ND1 mutation (Synthetic) Kim Apr 25, 2022
183898 TALED_Right-ND1-1397N TALED for ND1 mutation (Synthetic) Kim Apr 25, 2022
183897 TALED_Right-RNR2-1397N TALED for RNR2 mutation (Synthetic) Kim Apr 25, 2022
183896 TALED_Left-RNR2-1397C-AD TALED for RNR2 mutation (Synthetic) Kim Apr 25, 2022
183895 TALED_Left-ND1-E1347A TALED for ND1 mutation (Synthetic) Kim Apr 25, 2022
183894 TALED_Left-ND1-AD-E1347A TALED for ND1 mutation (Synthetic) Kim Apr 25, 2022
179998 pKB233.1 mNeonGreen (Other) Tabor Apr 25, 2022
183893 TALED_Left-ND1-1397C-UGI DDCBE for ND1 mutation (Synthetic) Kim Apr 25, 2022
183892 TALED_Left-ND1-1397C-AD TALED for ND1 mutation (Synthetic) Kim Apr 25, 2022
180473 pQFDBD-2x AD*-VP16*, α-cry:EGFP QFDBD-2xQFAD*-VP16* (Synthetic) Ro Apr 25, 2022
182575 pαH-S-GSAS-B.1.617.2.v1 Spike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (Other) Acharya Apr 25, 2022
183448 pFUGW NLS-FlpO NLS-FlpO (Synthetic) MacGillavry Apr 25, 2022
183425 pFUGW NLS-Cre NLS-Cre (Synthetic) MacGillavry Apr 25, 2022
183423 pOC4 cloning template vector MacGillavry Apr 25, 2022
183443 pORANGE Tubb3-2xGFP KI gRNA and 2xGFP donor (Mus musculus) MacGillavry Apr 25, 2022