Showing: 181 - 200 of 573 results
-
Plasmid#177645PurposeBacterial expression of Patiria miniata Dishevelled 1-90DepositorInsertDishevelled 1-90
UseTagsGSTExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
TR therapy reporter
Plasmid#179083PurposeFluorescent reporter for alternative splicingDepositorInsertsDsRed1
EGFP
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
PRExpress-Bxb1-hsp70pA
Plasmid#158391Purposeheat shock inducible Bxb1 integrase for drosophila melanogasterDepositorInsertBxb1
UseTagsExpressionInsectMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMV306hsp+LuxG13
Plasmid#26161DepositorInsertBacterial luciferase operon + G13 promoter
UseTagsExpressionBacterialMutationIt contains a gram-positive enhanced translation …PromoterAvailabilityAcademic Institutions and Nonprofits only -
pMSP2
Plasmid#26282DepositorInsertMSP2
UseTags6-HisExpressionBacterialMutationsynthetic gene of dimer of deletion mutant (1-43)…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pET21b-Tipin-His
Plasmid#23122DepositorInsertTipin (TIPIN Human)
UseTagsHisExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.Flag.HERC2-HECT-WT.6xHis
Plasmid#39227DepositorInsertHERC2 HECT Domain (HERC2 Human)
UseTags6xHis and FlagExpressionMammalianMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.Flag.HERC2-HECT-C4762A.6xHis
Plasmid#39228DepositorInsertHERC2 HECT Domain (HERC2 Human)
UseTags6xHis and FlagExpressionMammalianMutationC4762APromoterT7AvailabilityAcademic Institutions and Nonprofits only -
p063 pCS xTRPS1 delta N (M)
Plasmid#11036DepositorInsertTRPS1 deltaN mut (trps1 Frog)
UseMammalian, avian, and zebrafishTagsExpressionMutationaa806-1153 of xTRPS1. Two Cys residues in the GA…PromoterAvailabilityAcademic Institutions and Nonprofits only -
p068 pCS mTRPS1 (M)
Plasmid#11040DepositorInsertTRPS1 mut (Trps1 Mouse)
UseXenopus, mammalian, avian, and zebrafishTagsExpressionMutationTwo Cys residues at positions 917 and 920 in the …PromoterAvailabilityAcademic Institutions and Nonprofits only -
p075 pCS xTRPS1 delN delC119 (M)
Plasmid#11045DepositorInsertTRPS1 delN delC119 mut (trps1 Frog)
UseXenopus, mammalian, avian, and zebrafishTagsExpressionMutationaa806-1153 of xTRPS1. Two Cys residues in the GA…PromoterAvailabilityAcademic Institutions and Nonprofits only -
p076 pCS xTRPS1 delN delC320 (M)
Plasmid#11046DepositorInsertTRPS1 (trps1 Frog)
UseMammalian, avian, and zebrafishTagsExpressionMutationaa806-952 of xTRPS1. Two Cys residues in the GAT…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-RhoA-wt
Plasmid#12965DepositorInsertRhoA (RHOA Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
-
pAJM.847
Plasmid#108524PurposePhlFAM + PPhlF-YFP Reporter. DAPG sensor for use in non-Marionette strain.DepositorInsertPhlFAM + PPhlF-YFP
UseTagsExpressionBacterialMutationPhlF: S50G S73I R95H A121V M137I N144D T155I R200CPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAJM.1642
Plasmid#108535PurposeCinRAM + PCin-YFP Reporter. OHC14 sensor for use in non-Marionette strain.DepositorInsertCinRAM + PCin-YFP
UseTagsExpressionBacterialMutationCinR: S72C V80I G114D G115D R137H K220R A224T *24…PromoterAvailabilityAcademic Institutions and Nonprofits only -
DT12A
Plasmid#80416PurposeExpresses 12 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
DT0
Plasmid#80418PurposeExpresses 0 CUG repeats in the context of human DMPK genomic segment containing exons 11-15 with repeats inserted at site in exon 15 that contains the repeatsDepositorInserthuman DMPK exons 11-15 with 0 CTG repeats (DMPK Human)
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailabilityAcademic Institutions and Nonprofits only
Showing: 181 - 200 of 573 results