Addgene

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

We narrowed to 4 results for: th

Showing: 1 - 4 of 4 results

A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression

Type

Blog Post

...transiently express TH during development or have low levels of TH mRNA without expressing TH protein indicating...promoter, such as the truncated tyrosine hydroxylase (TH) promoter for catecholamine neurons or glial fibrillary...
Viral Vectors 101: AAV Variables That Matter

Type

Blog Post

...associated protein (GFAP), or tyrosine-hydroxylase (TH), can limit which cells express your gene. Off-target...for example, some neurons can transiently express TH - so you’ll need to check for this in your system...
Cancer and the Immune System: Deciphering the Relationship

Type

Blog Post

... (CTLs), natural killer (NK) cells, and helper T (Th) cells. These cells produce inflammatory cytokines...effector immune cells. TGFβ is also known to change CD4+ Th cells into regulatory cells to suppress function....
Validated gRNA Sequences

Type

Collection

...25480939 Sibley th D. rerio GGATGCGCGTAAGGAGCGCG 42247 cut S. pyogenes 23360964 Joung th D. rerio GGGTTGTTACACTCATAAAG...

Showing: 1 - 4 of 4 results