We narrowed to 4 results for: th

1. A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression

   Type

   Blog Post

   ...transiently express TH during development or have low levels of TH mRNA without expressing TH protein indicating...promoter, such as the truncated tyrosine hydroxylase (TH) promoter for catecholamine neurons or glial fibrillary...

2. Viral Vectors 101: AAV Variables That Matter

   Type

   Blog Post

   ...associated protein (GFAP), or tyrosine-hydroxylase (TH), can limit which cells express your gene. Off-target...for example, some neurons can transiently express TH - so you’ll need to check for this in your system...

3. Cancer and the Immune System: Deciphering the Relationship

   Type

   Blog Post

   ... (CTLs), natural killer (NK) cells, and helper T (Th) cells. These cells produce inflammatory cytokines...effector immune cells. TGFβ is also known to change CD4+ Th cells into regulatory cells to suppress function....

4. Validated gRNA Sequences

   Type

   Collection

   ...25480939 Sibley th D. rerio GGATGCGCGTAAGGAGCGCG 42247 cut S. pyogenes 23360964 Joung th D. rerio GGGTTGTTACACTCATAAAG...