We narrowed to 7,002 results for: tac
-
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-tagBFP
Plasmid#219965Purposeexpress TagBFP in mammalian cellsDepositorInsertTagBFP
UseRetroviralExpressionMammalianAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YBL055C
Plasmid#166077PurposePlasmid for constituive spCas9 and tet-inducible YBL055C targeting sgRNA expression for double stranded break formation in yeastDepositorInsertYBL055C (near PTC3) (YBL055C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_TDH2
Plasmid#166082PurposePlasmid for constituive spCas9 and tet-inducible TDH2 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
SDCBPA-c000
Plasmid#175480PurposeProtein expression in bacterial cells. Entire CDS, M1-V288.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPR1_c3gRNA_RPR1t
Plasmid#64381Purposeencodes c3 gRNADepositorInsertc3 gRNA
ExpressionYeastAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
H2B-Electra2
Plasmid#218929PurposeElectra2 fused to human H2B protein for nuclear localizationDepositorInsertH2B-Electra2 (H2B Entacmaea quadricolor, Synthetic, Human)
UseSynthetic BiologyTagsElectra2 and H2BExpressionMammalianAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SDCBPA-c020
Plasmid#175484PurposeProtein expression in bacterial cells. PDZ1 and PDZ2 domains, G111-V288.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIB184-Km
Plasmid#90195PurposeE. coli - Streptococci shuttle plasmid for gene expression in streptococci with P23 promoterDepositorTypeEmpty backboneTagsNoneExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-Max-N1
Plasmid#21718DepositorInsertDsRed-Max
ExpressionMammalianAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
KG#865
Plasmid#110912PurposeCoding sequence for attaching the Auxin Inducible Degron to the C-terminus of a protein followed by a 5X Myc tag with spacersDepositorInsertAuxin Inducible Degron-5X Myc-Spacers for C-terminal attachment
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#883
Plasmid#110913PurposeCoding sequence for attaching the a 5X Myc tag with spacers followed by the Auxin Inducible Degron to the N-terminus of a proteinDepositorInsert5X Myc-Spacers-Auxin Inducible Degron for N-terminal attachment
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
SDCBPA-c010
Plasmid#175482PurposeProtein expression in bacterial cells. PDZ1 and PDZ2 domains, A106-V288. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
SDCBPA-c021
Plasmid#175485PurposeProtein expression in bacterial cells. PDZ1 and PDZ2 domains (truncated at C-terminus), G111-F275.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
SDCBPA-c011
Plasmid#175483PurposeProtein expression in bacterial cells. PDZ1 and PDZ2 domains (truncated at C-terminus), A106-F275.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only