We narrowed to 15,231 results for: invs
-
Plasmid#248970PurposeExpresses recombinant fluorescent CYRI-B (Fam49B) protein in mammalian cells, specifically human Cyri-B with internal mCherry after proline 17, preserving the proposed N-terminal myristoylation site.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only
-
p17-GFP-CYRI-B
Plasmid#248969PurposeExpresses recombinant fluorescent CYRI-B (Fam49B) protein in mammalian cells, specifically human Cyri-B with internal GFP after proline 17, preserving the proposed N-terminal myristoylation site.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
p16-mCherry-CYRI-A
Plasmid#247375PurposeExpresses recombinant fluorescent CYRI-A (Fam49A) protein in mammalian cells, specifically mouse Cyri-A with internal mCherry after proline 16, preserving the proposed N-terminal myristoylation site.DepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEF1-H2B-mRFP1-pcdk1-EGFP1-FRT
Plasmid#247334PurposeExpresses histone H2B fused with mRFP1, together with monomeric EGFPDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_blast_FAM136A_sg2
Plasmid#244876PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_puro_FAM136A_sg1
Plasmid#244877PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgOMA1 sg2
Plasmid#244866PurposeKnockout of human OMA1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_blast_FAM136A_sg1
Plasmid#244875PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_puro_FAM136A_sg2
Plasmid#244878PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgOMA1 sg1
Plasmid#244865PurposeKnockout of human OMA1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pH-2×35S-DualPE
Plasmid#236416PurposeFor plant prime editing including large DNA fragment editing in Nicotiana benthamiana or other dicotyledonsDepositorInserts2×35S promoter
hygromycin-resistance gene
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-ABL2(K281M)
Plasmid#215470PurposeDox-inducible lentiviral transfer vector with Arg kinase-dead (K281M)DepositorInsertABL2 (ABL2 Human)
UseLentiviralMutationK281M (kinase-inactivating)PromotermCMV, Doxycycline-inducibleAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NPM1c-TurboID-MSCV-IRES-GFP
Plasmid#240129PurposeExpresses mutant NPM1c-TurboID fusion in mammalian cellsDepositorInsertNPM1c (NPM1 Human)
UseRetroviralTagsIRES-GFP and TurboIDExpressionMammalianMutationC-terminal frameshift mutation as seen in Acute M…Available SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-TRE>hHES3:T2A:EGFP
Plasmid#236630PurposeHygromycin selected lentiviral construct with tetracyclin-inducible human HES3DepositorInsertsUseLentiviralExpressionMammalianMutationCodon optimized based on a variant of wildtype GF…PromoterTREAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Gluc-NHP.RMA-IRES-EGFP
Plasmid#227886PurposeExpresses Gluc-NHP.RMA and EGFP under the hSyn promoter. Gluc-NHP.RMA for monitoring neuronal transduction.DepositorInsertsGaussia luciferase fused to macaque Fc
IRES-EGFP
UseAAV and LuciferaseTagsGluc and IgG1 FcExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-PTPN11-Clover
Plasmid#215519PurposeGateway entry vector with clover-tagged Shp2DepositorAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEF.DEST51-PTPN11-Clover
Plasmid#215525PurposeExpression vector with clover-tagged Shp2DepositorAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term D-N/E-Q
Plasmid#233095PurposeExpression of GST-YihI with N-term aspartic acids (D) mutated to asparagine (N) and glutamic acids (E) mutated to glutamine (Q)DepositorInsertYihI with N-term aspartic acids (D) mutated to asparagine (N) and glutamic acids (E) mutated to glutamine (Q)
TagsGSTExpressionBacterialMutationN-term aspartic acids (D) mutated to asparagine (…Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term D-A/E-L
Plasmid#233097PurposeExpression of GST-YihI with N-term aspartic acids (D) mutated to alanine (A) and glutamic acids (E) mutated to leucine (L)DepositorInsertYihI with N-term aspartic acids (D) mutated to alanine (A) and glutamic acids (E) mutated to leucine (L)
TagsGSTExpressionBacterialMutationN-term aspartic acids (D) mutated to alanine (A) …Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits