...elements, but among the most important are the inverted terminal repeats (ITRs). ITRs are the elements...2020). Adeno-Associated Virus Serotype-Specific Inverted Terminal Repeat Sequence Role in Vector Transgene...Merten, O.-W., & Galibert, L. (2017). Impact of Inverted Terminal Repeat Integrity on rAAV8 Production ..., & Logan, G. J. (2019). A User’s Guide to the Inverted Terminal Repeats of Adeno-Associated Virus. Hum...2017). Deletion of the B-B’ and C-C’ regions of inverted terminal repeats reduces rAAV productivity but...

...we introduce you to the Journal of Emerging Investigators, an open-access journal that enables high school... the interview with the Journal of Emerging Investigators Podcast breakdown Intro Chapter 1 - Introduction...Olivia Ho-Shing, and the Journal of Emerging Investigators. Chapter 2 - Getting high school students and...achieving it. Chapter 5 - JEI's future - getting more involved in the classroom by building curricula and developing...

...to access, which often forces scientists to use invasive measures to perform in vivo optogenetic experiments... channelrhodopsin-based optogenetics minimally-invasive, Frances Arnold’s lab and Viviana Gradinaru’s ...have photocurrent properties best suited for less-invasive optogenetics experiments. The sequences in this...paired with a systemic AAV allow for minimally-invasive optogenetics While ChRgers performed well in a... see if they were suited for in vivo minimally invasive optogenetics. Both experiments delivered ChRgers... In the first experiment, ChRger2 was non-invasively delivered to the dopamine producing neurons in..., ChRger2 was delivered and activated with non-invasive methods to the neurons in the right secondary ...

...infection, such as ACE2 and TMPRSS2, which are involved in the entry of SARS-CoV and SARS-CoV-2. Find ...protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme...superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 4 ) Cathepsin L -...infectivity.( 6 ) PCP4 - (Purkinje cell protein 4) is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV... BSG - Wang, K et al, 2020, BioRxiv SARS-CoV-2 invades host cells via a novel route: CD147-spike protein...

...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play...Prepare recombinant tau, HSPA1L, and other proteins involved in gene networks mediation regional resistance... Chemogenetics Plasmids. New and Noteworthy: Investigate aggregate formation in amyotrophic lateral sclerosis...

...as a powerful defensive strategy against viral invaders, and this system is proving to be just as useful...CRISPR-associated (Cas) genes to not only store a record of invading phages but also to destroy the phages upon re-... the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...to ensure prokaryotic survival, but it is not invincible. Bondy-Denomy et al. identified the first set...

...receive a ready-to-use viral preparation from the inventory below. AAV are distributed as 100 µL solutions...filtering by the serotype needed. Penn Vector Core Inventory The University of Pennsylvania Vector Core (Link...distribution. All items are listed on the Addgene inventory pages above (By Function or By Serotype). Convert...

...CRISPR plasmids to study the regulatory networks involved in retinal development....Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...aide in their studies of the regulatory networks involved in retinal development the lab utilizes a CRISPR...

... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...

...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...

...three types of rearrangements: inversion, deletion and translocation. Inversion: If the loxP sites are on ...opposite orientations, recombination results in an inversion and the region of DNA between the loxP sites is...binding to these sites can result in excision, inversion or translocation depending on the orientation ...

...cycle. Chemically or genetically inhibiting genes involved in NHEJ may also increase HDR frequency. Additionally...Cas9-CtIP , a fusion of Cas9 and CtIP, a protein involved in double-stranded break resection, can contribute...for conducting genome-wide screens using CRISPR involves the use of pooled lentiviral CRISPR libraries....various bacteria and archaea to protect against invading nucleic acids, such as phage genomes. Because ...frequency and exact sequence of targeted alleles. Involves PCR amplification of targeted region from DNA,...

...from the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution...

...receptor-ligand interactions that function in the invasion of the human erythrocyte by the blood stage of...Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Crosnier C et al., Nature...

...receptor-ligand interactions that function in the invasion of the human erythrocyte by the blood stage of...Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Crosnier C et al., Nature...

...experiments. For more information, see our full AAV inventory or our AAV production page . Note: For a list ...100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample...

... pairs of TALEN plasmids targeting human genes involved in cancer and epigenetic regulation from the Joung...series of engineered TALENs targeted to human genes involved in cancer and/or epigenetic regulation ( Reyon...

...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified...Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more information...

...variety of pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. ...Transcription factor Dp TIAM TIAM1 TIAM2 T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1...

... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...