...elements, but among the most important are the inverted terminal repeats (ITRs). ITRs are the elements...2020). Adeno-Associated Virus Serotype-Specific Inverted Terminal Repeat Sequence Role in Vector Transgene...Merten, O.-W., & Galibert, L. (2017). Impact of Inverted Terminal Repeat Integrity on rAAV8 Production ..., & Logan, G. J. (2019). A User’s Guide to the Inverted Terminal Repeats of Adeno-Associated Virus. Hum...2017). Deletion of the B-B’ and C-C’ regions of inverted terminal repeats reduces rAAV productivity but...

...we introduce you to the Journal of Emerging Investigators, an open-access journal that enables high school... the interview with the Journal of Emerging Investigators Podcast breakdown Intro Chapter 1 - Introduction...Olivia Ho-Shing, and the Journal of Emerging Investigators. Chapter 2 - Getting high school students and...achieving it. Chapter 5 - JEI's future - getting more involved in the classroom by building curricula and developing...

...to access, which often forces scientists to use invasive measures to perform in vivo optogenetic experiments... channelrhodopsin-based optogenetics minimally-invasive, Frances Arnold’s lab and Viviana Gradinaru’s ...have photocurrent properties best suited for less-invasive optogenetics experiments. The sequences in this...paired with a systemic AAV allow for minimally-invasive optogenetics While ChRgers performed well in a... see if they were suited for in vivo minimally invasive optogenetics. Both experiments delivered ChRgers... In the first experiment, ChRger2 was non-invasively delivered to the dopamine producing neurons in..., ChRger2 was delivered and activated with non-invasive methods to the neurons in the right secondary ...

...infection, such as ACE2 and TMPRSS2, which are involved in the entry of SARS-CoV and SARS-CoV-2. Find ...protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme...superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 4 ) Cathepsin L -...infectivity.( 6 ) PCP4 - (Purkinje cell protein 4) is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV... BSG - Wang, K et al, 2020, BioRxiv SARS-CoV-2 invades host cells via a novel route: CD147-spike protein...

...Multiplex Genome Engineering Many CRISPR experiments involve editing more than one gene. In these cases, delivering...using Cas9 to generate large genomic deletions or inversions with two gRNA sites on the same chromosome. Most...phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating those in the HDR pathway...flexible than base editing: it can encode edits involving any new sequence (point mutations, insertions,...for conducting genome-wide screens using CRISPR involves pooled lentiviral CRISPR libraries. Figure 8: ...Modifications Using CRISPR A variation of CRISPRi/a involves dCas9 fused to epigenetic modifiers. These programmable...off-target alterations, such as small mutations or inversions, than do large deletions generated by Cas9 systems...

...as a powerful defensive strategy against viral invaders, and this system is proving to be just as useful...CRISPR-associated (Cas) genes to not only store a record of invading phages but also to destroy the phages upon re-... the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...to ensure prokaryotic survival, but it is not invincible. Bondy-Denomy et al. identified the first set...

...Luciferase-containing plasmids are commonly used to investigate the effect of regulatory elements, such as promoters...212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz.../Puro) RapidResponse(TM) Renilla Vector for investigating regions controlling transcription Pete Stecha...212933 pGL4.84(hRlucCP/Puro) Renilla Vector for investigating regions controlling transcription Pete Stecha...

...CRISPR plasmids to study the regulatory networks involved in retinal development....Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...aide in their studies of the regulatory networks involved in retinal development the lab utilizes a CRISPR...

... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...

...three types of rearrangements: inversion, deletion and translocation. Inversion: If the loxP sites are on ...opposite orientations, recombination results in an inversion and the region of DNA between the loxP sites is...binding to these sites can result in excision, inversion or translocation depending on the orientation ...

...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...

... plasmid tools generated by IGVF Consortium investigators to examine how genomic variation affects genome...collaborative program that brings together teams of investigators who will use state-of-the-art experimental and...

...from the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution...

...experiments. For more information, see our full AAV inventory or our AAV production page . Note: For a list ...100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample...

...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified...Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more information...

...variety of pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. ...Transcription factor Dp TIAM TIAM1 TIAM2 T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1...

...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play...

... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...

...immunology collection contains plasmids for genes involved in innate and adaptive immune signaling and cell-cell...such as macrophages and neutrophils that attack invading pathogens. Innate immune cells also process and...membrane and can also function as signaling proteins involved in proliferation, cell differentiation, and apoptosis...molecule, major histocompatibility complex, class II invariant chain DHLAG, HLADG, Ia-GAMMA CD8A CD8a molecule...

...for cell migration research at Addgene. CMC investigators who have deposited plasmids include: Joan Brugge...