...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...

...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements... rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen F- gyrA462 endA Delta(sr1-recA) mcrB mrr hsdS20...proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 ...rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC) Stbl3 Invitrogen F– mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara...proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 ...

...cycle. Chemically or genetically inhibiting genes involved in NHEJ may also increase HDR frequency. Additionally...Cas9-CtIP , a fusion of Cas9 and CtIP, a protein involved in double-stranded break resection, can contribute...for conducting genome-wide screens using CRISPR involves the use of pooled lentiviral CRISPR libraries....various bacteria and archaea to protect against invading nucleic acids, such as phage genomes. Because ...frequency and exact sequence of targeted alleles. Involves PCR amplification of targeted region from DNA,...

...renders the virus replication incompetent. E3 is involved in evading host immunity and is not essential ... replication incompetent E3 Non-essential gene involved in immune evasion, deleted to increase packaging...cell line Transfer Vocabulary Term Definition ITR Inverted terminal repeat; Contains elements that promote...

...homologous recombination of unstable regions, such as Invitrogen Stbl3™ or NEB Stable cells. This will ensure ...with which the attP sequences recombine. Visit Invitrogen's website for more information on the Gateway®...

...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...

...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...

...those cells that pass (“win”) Get a list of genes involved in the selection NEGATIVE screen: Apply library...

...operator preventing transcription. The trp operon involved in the production of tryptophan is an example ...

...reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). These ITRs base pair ...

...downstream signalling. GPCRs have been shown to be involved in a wide variety of biological processes, including...

...fluorophores used is important. It is best to inversely pair the brightness of the fluorophore with the...