Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 13 results for: invs

Showing: 1 - 13 of 13 results

  1. Sequencing Primers

    Type
    Guide
    ...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...

  2. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...reading frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes...proteins (Rep78, Rep68, Rep52, and Rep40), which are involved in genome replication and viral packaging. The...barrier (BBB), and a systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic...this rate-limiting step, scAAVs contain a dimeric inverted repeat DNA molecule that spontaneously reanneals...Gradinaru, V. (2017). Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous...Transfer/Shuttle plasmid 5' ITR (LITR) in cis Left Inverted Terminal Repeat, contains a Rep binding element...replication and packaging. 3' ITR (RITR) in cis Right Inverted Terminal Repeat, contains a Rep binding element...

  3. Molecular Biology Reference

    Type
    Guide
    ...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements... rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen F- gyrA462 endA Delta(sr1-recA) mcrB mrr hsdS20...proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 ...rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC) Stbl3 Invitrogen F– mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara...proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 ...

  4. Adenovirus Guide

    Type
    Guide
    ...multiple heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are ... cargo in first-generation rAdV vectors. E3 is involved in evading host immunity and is not essential ...Transfer/Shuttle plasmid 5' ITR (LITR) in cis Left Inverted Terminal Repeat, serve as self-priming structures...primase-independent DNA replication. 3' ITR (RITR) in cis Right Inverted Terminal Repeat, serve as self-priming structures...E4 in trans Adenoviral early transcript regions involved in viral DNA replication and host cell manipulation...immunity Specific and long-lasting immune response involving specialized immune cells and antibody production...

  5. CRISPR Guide

    Type
    Guide
    ...Multiplex Genome Engineering Many CRISPR experiments involve editing more than one gene. In these cases, delivering...using Cas9 to generate large genomic deletions or inversions with two gRNA sites on the same chromosome. Most...phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating those in the HDR pathway...flexible than base editing: it can encode edits involving any new sequence (point mutations, insertions,...for conducting genome-wide screens using CRISPR involves pooled lentiviral CRISPR libraries. Figure 8: ...Modifications Using CRISPR A variation of CRISPRi/a involves dCas9 fused to epigenetic modifiers. These programmable...off-target alterations, such as small mutations or inversions, than do large deletions generated by Cas9 systems...

  6. Lentiviral Vector Guide

    Type
    Guide
    ...transcriptionally active regions, regions recently involved in translocation events, and other “fragile” genomic...an efficient way to determine what genes may be involved in different biological processes by surveying... mutants for various phenotypes. These screens involve hundreds to even thousands of target genes and ...

  7. Optogenetics Guide

    Type
    Guide
    ...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...

  8. Science Guides

    Type
    Guide
    ...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...

  9. Guide to Using Pooled Libraries

    Type
    Guide
    ...those cells that pass (“win”) Get a list of genes involved in the selection NEGATIVE screen: Apply library...

  10. Promoters

    Type
    Guide
    ...operator preventing transcription. The trp operon involved in the production of tryptophan is an example ...

  11. Plan Your Experiment

    Type
    Guide
    ...frequency and exact sequence of targeted alleles. Involves PCR amplification of targeted region from DNA,...

  12. Chemogenetics Guide

    Type
    Guide
    ...downstream signaling. GPCRs have been shown to be involved in a wide variety of biological processes, including...

  13. Antibody Guide

    Type
    Guide
    ...fluorophores used is important. It is best to inversely pair the brightness of the fluorophore with the...
Showing: 1 - 13 of 13 results