We narrowed to 10,320 results for: Uty
-
Plasmid#125773Purposeconstitutive expression of a guide RNA targeting human WRNDepositorInsertsgWRN3 (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Synthetic, Human)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4342 TNFR1 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244178PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): TNFR1SS-3xFLAG-TNFR1ECD(dMMP)-TNFR1TMD-CTEVp(75S)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human TNFR1 SS, ECD (no MMP site) and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (TNFRSF1A Synthetic, Human)
UseSynthetic BiologyTagsTNFR1 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4341 TNFR1 NTEVp chain (deleted MMP site) in PolyTX-mNeonGreen
Plasmid#244176PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR1SS-3xFLAG-TNFR1ECD(dMMP)-TNFR1TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR1 SS and ECD (no MMP site), murine CD28 TMD, and NTEVp 75S mutant (TNFRSF1A Synthetic, Human)
UseSynthetic BiologyTagsTNFR1 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF6x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235307PurposeLentiviral expression of ComMAND open-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235303PurposeLentiviral expression of ComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235304PurposeLentiviral expression of ComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF4x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235308PurposeLentiviral expression of ComMAND closed-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only