We narrowed to 7,043 results for: plasmid dna
-
Plasmid#212707PurposeTornado split nLuc with a mutated 3' ribozyme so that circularization cannot occur.DepositorInsertmutTornado-CVB3-split-nLuc
MutationDeleted the partial 3'ribozyme sequence in T…Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL
Plasmid#80266Purposemammalian expression plasmid for MycLAP-STILDepositorAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Tras light chain
Plasmid#216294PurposeExpresses anti-HER2 Tras Light chain in mammalian cells. To be paired with Tras heavy chain to form the anti-HER2 Tras FabDepositorInsertTras light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Pert Light chain
Plasmid#216310PurposeExpresses anti-HER2 Pert Light chain in mammalian cells. To be paired with Pert heavy chain to form the anti-HER2 Pert FabDepositorInsertPert Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-39S Light chain
Plasmid#216297PurposeExpresses anti-HER2 39S Light chain in mammalian cells. To be paired with 39S heavy chain to form the anti-HER2 39S FabDepositorInsert39S Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MF3958 Light chain
Plasmid#216304PurposeExpresses anti-HER2 MF3958 Light chain in mammalian cells. To be paired with MF3958 heavy chain to form the anti-HER2 MF3958 FabDepositorInsertMF3958 Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only