We narrowed to 17,281 results for: REV

#200133

Type 4a part for Modular Cloning in Yeast

Johannes Herrmann

Simakin et al Microb Cell. 2023 Feb 28;10(4):78-87. do

May 3, 2023

Academic Institutions and Nonprofits only

#200138

Type 3a part for Modular Cloning in Yeast

Johannes Herrmann

Simakin et al Microb Cell. 2023 Feb 28;10(4):78-87. do

May 3, 2023

Academic Institutions and Nonprofits only

#190817

For C-terminus 3xGFP tagging of a gene of interest using URA3 selection marker in S. cerevisiae

Tatiana Karpova, Gunjan Mehta

Ball et al Nucleic Acids Res. 2016 Dec 1;44(21):e16

Nov. 29, 2022

Academic Institutions and Nonprofits only

#185078

rfa3D46 truncation fused to GFP

Ken Belanger

Belanger et al DNA Cell Biol. 2011 Sep;30(9):641-51. do

July 28, 2022

Academic Institutions and Nonprofits only

#169924

WT Ecm2 mutated to introduce stop codon after AA 197 of Ecm2

Aaron Hoskins

van der Feltz et al RNA. 2021 Feb 5. pii: rna.077727.120. do

Oct. 19, 2021

Academic Institutions and Nonprofits only

#123288

Expression of truncated Glo3 (137-459) in E.Coli

Blanche Schwappach

Arakel et al J Cell Sci. 2019 Aug 29;132(16). pii: jc

Sept. 25, 2020

Academic Institutions and Nonprofits only

#87390

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only