We narrowed to 33,895 results for: Jun
-
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATM HRD
Plasmid#207085PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous ATM locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD3 HRD
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD1 HRD
Plasmid#207076PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD1 locus.DepositorInsertHaloTag flanked by human SHLD1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T_CAG_SpCas9PE2_5plinker_BlastR
Plasmid#173066PurposeExpresses PE2DepositorInsert5plinker
ExpressionMammalianAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP578
Plasmid#222957PurposeExpresses R144S LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 144 to SerinePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP577
Plasmid#222956PurposeExpresses K142S LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Lysine 142 to SerinePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP576
Plasmid#222955PurposeExpresses R141S LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 141 to SerinePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP575
Plasmid#222954PurposeExpresses R36S LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 36 to SerinePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP573
Plasmid#222952PurposeExpresses E40H LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Glutamate 40 to HistidinePromoterT7Available SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_VPS26C
Plasmid#209690PurposeExpresses MAC-tagged VPS26C in mammalian cellsDepositorAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP572
Plasmid#222951PurposeExpresses E40A LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Glutamate 40 to AlaninePromoterT7Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-T86E
Plasmid#206148PurposePGK EGFP-RAB3A-T86EDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-T86A
Plasmid#206149PurposePGK EGFP-RAB3A-T86ADepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ChmN-C47A
Plasmid#221367PurposeExpress C47A ChmN in E. coliDepositorInsertchmN-C47A
TagsHis6ExpressionBacterialMutationchanged Cys 47 to AlaAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pReporter_ZF2_ZF1_mNeonGreen
Plasmid#213834PurposeFacilitates genomic integration of the reporter for screen 1: ZF-1 followed by ZF-2 upstream of the reporter gene.DepositorInsertmNeonGreen
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pReporter_ZF1_mNeonGreen_ZF2
Plasmid#213835PurposeFacilitates genomic integration of the reporter for screen 2: ZF-1 upstream of the reporter gene and ZF-2 downstream.DepositorInsertmNeonGreen
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pReporter_ZF1_ZF2_mNeonGreen
Plasmid#213836PurposeFacilitates genomic integration of the reporter for screen 3: ZF-2 followed by ZF-1 upstream of the reporter gene.DepositorInsertmNeonGreen
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pReporter_ZF2_mNeonGreen_ZF1
Plasmid#213837PurposeFacilitates genomic integration of the reporter for screen 4: ZF-2 upstream of the reporter gene and ZF-1 downstream.DepositorInsertmNeonGreen
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtet-1_mNeonGreen_Ptet-2_mCherry
Plasmid#213839PurposeExpression of mNeonGreen and mCherry from aTc-inducible Ptet promoters.DepositorInsertmNeonGreen, mCherry
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtet-2-VP16
Plasmid#213842PurposeUsed for expressing VP16 fused to ZF-2.DepositorInsertVP16
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtet-1-VP16
Plasmid#213843PurposeUsed for expressing VP16 fused to ZF-1.DepositorInsertVP16
ExpressionYeastAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-AC17-5c-frGFP
Plasmid#217525PurposeAC17-5c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertAC17-5c riboswitch-regulated folding reporter GFP
UseIn vitro transcription-translationPromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD2 HRD
Plasmid#207078PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD2 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD2 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL661-TTTA
Plasmid#215865PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL661 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL714-TTTA
Plasmid#215867PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL714 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864-TTTA
Plasmid#215859PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL864R-TTTA
Plasmid#215861PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL864R with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperCRISPR-sgRNA-RL554-TTTA
Plasmid#215863PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL554 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD
Plasmid#216396PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1DepositorInsertEfg1-ΔDBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-356Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPIBY55
Plasmid#213706PurposeExpress the affinity sorting tag TST-EGFP- GPIBY55.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPICEAM7
Plasmid#213705PurposeExpress the affinity sorting tag TST-EGFP- GPICEAM7.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTST-EGFP-GPIDAF
Plasmid#213704PurposeExpress the affinity sorting tag TST-EGFP- GPIDAF.DepositorInsertEGFP
TagsTwin-strep-tagExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-TREER
Plasmid#208321PurposeBacterial expression of the His-tagged peptide TREER.DepositorInsertTREER
TagsDBCO-Tag, His-TagExpressionBacterialAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor_RB-TnV2_pJEx
Plasmid#213908PurposeBarcoded mariner transposon with crystal violet-inducible outward promoter - barcodes can be added via FseI-SbfI restriction sitesDepositorInsertmariner transposon with kan resistance and EilR/pJEx and FseI-SbfI sites for barcode insertion
ExpressionBacterialAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-EGFP-Cre
Plasmid#207132PurposeLentiviral vector to express EGFP-CreDepositorInsertEGFP-Cre
UseLentiviralPromoterSSFVAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only