We narrowed to 14,178 results for: Ung;
-
Plasmid#218674PurposeInsect cell expression of a rat MUNC13-1 fragment containing domains C1C2BMUNC2CDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pJL32
Plasmid#174066PurposeEncodes for CIB1 fused to VP16 in S. cerevisiae. Part of optogenetic system.DepositorInsertpGal1-LacO-3NLS-CIB1-VP16-tADH1
TagsFLAGExpressionYeastPromoterpGal1Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH4725
Plasmid#178796PurposePdpy-30 DAF-2 unc-54 3' UTR C.elegans pan-tissue expression of DAF-2DepositorAvailable SinceJan. 5, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH3113
Plasmid#178795PurposePgref-1KPC-1 mini-gene unc-54 3' UTR C.elegans neuron and tissue expression of KPC-1DepositorAvailable SinceJan. 5, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH1498
Plasmid#178600PurposePrgef-1 INS-18::GFP unc-54 3' UTR C.elegans pan-neural expression of INS-18 fused to GFPDepositorAvailable SinceJan. 5, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJL50
Plasmid#174068PurposeExpresses 97-3 zinc finger array fused to VP16 in S. cerevisiae. Parent plasmid for chromatin regulator library.DepositorInsertpTEF1-3NLS-97-3ZF-VP16
TagsFLAGExpressionYeastPromoterpTEF1Available SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL45
Plasmid#174067PurposeExpresses CIB1 in S. cerevisiae. Includes inducible lac operon.DepositorInsertpGal1-LacO-3NLS-CIB1-tADH1
TagsFLAGExpressionYeastPromoterpGal1Available SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-TIR1-tTA/Zeo
Plasmid#171685Purposeconstitutive expression of TIR1-myc and tTA in sleeping beauty transposon vector with selection marker (zeocin)DepositorInsertZeocin
ExpressionMammalianPromoterRPBSA promoterAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL1
Plasmid#174070PurposeExpresses VP16-CIB1 in S. cerevisiae. Part of optogenetic system.DepositorInsertpGal-Olac-3xNLS-VP16-CIB1-tADH1
TagsFLAGExpressionYeastPromoterpGal1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL29
Plasmid#174063PurposeExpresses for mCherry for S. cerevisiae. Contain 2 43-8 zinc-finger operators upstream of Cyc1 promoter.DepositorInsert2x43-8 ZFO-1x97-4 ZFO pCyc mCherry tCyc
TagsFLAGExpressionYeastPromoterpCyc1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-3'UTR
Plasmid#136052PurposeREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-lambdaN-UPF1-DEAA
Plasmid#136007PurposeDEAA UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB)DepositorInsertUPF1
TagsLambdaNExpressionMammalianMutationDE647AA and S743A (Please see depositor comments …Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEYRC-D1A
Plasmid#127753PurposeResearch the effect of gene orientation of transcriptionDepositorInsertRFP, CFP, Divergent Orientation
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEYRC-C1A
Plasmid#127752PurposeResearch the effect of gene orientation of transcriptionDepositorInsertRFP, CFP, Convergent Orientation
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMY07AB-PRO
Plasmid#127710PurposeLevel 0 destination vector for a promoter with A - B scars. Clone in with BpiIDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFGL1259R
Plasmid#118995PurposemCherry (without start and stop codons) in pGFL1010DepositorInsertmCherry (without start and stop codons)
UseFungal expressionPromoterpromoter lessAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFGL1260
Plasmid#116900PurposeeGFP:TubA (tubulin marker )DepositorInsertsTubA promoter
TubA (ORF+3'UTR)
UseFungal expression (in magnaporthe oryzae)Available SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFGL1260R
Plasmid#116901PurposemCherry:TubA (tubulin marker)DepositorInsertsTubA promoter
TubA (ORF+3'UTR)
UseFungal expression (in magnaporthe oryzae)Available SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only