We narrowed to 6,255 results for: tTA
-
Plasmid#243777PurposeExpresses multifunctional construct enabling the AND-gated release of mGreenLantern from materials in response to sortase eSrtA(4S9) AND TEV treatment. Contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
mGreenLantern- A AND (S OR T)-SpyTag
Plasmid#243778PurposeExpresses multifunctional construct enabling the AND(OR)-gated release of mGreenLantern from materials in response to sortase eSrtA(2A9) AND (sortase eSrtA(4S9) OR TEV) treatment. Contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
mGreenLantern- S AND (A OR T)-SpyTag
Plasmid#243779PurposeExpresses multifunctional construct enabling the AND(OR)-gated release of mGreenLantern from materials in response to sortase eSrtA(4S9) AND (sortase eSrtA(2A9) OR TEV) treatment. Contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
mGreenLantern- T AND (A OR S)-SpyTag
Plasmid#243780PurposeExpresses multifunctional construct enabling the AND(OR)-gated release of mGreenLantern from materials in response to TEV AND (sortase eSrtA(2A9) OR sortase eSrtA(4S9)) treatment. Contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced MUT
Plasmid#242750PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MBP-Streptavidin-RGG
Plasmid#242451PurposeExpresses the MBP-Streptavidin-RGG fusion protein in E Coli.DepositorInsertMBP-Streptavidin-RGG (using LAF-1 RGG domain)
TagsMBP and SteptavidinExpressionBacterialAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
P-d22bp
Plasmid#235657PurposeB. thetaiotaomicron fusA2 expression reporter lacking 22bp Cur binding siteDepositorInsertBacteroides thetaiotaomicron fusA2 promoter lacking the 22bp Cur binding site
MutationThe B. thetaiotaomicron fusA2 promoter lacking &q…Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-Flag-IF1-Fibcon-icam
Plasmid#233076Purposeexpresses synCAM -IF1-fibcon - iCAM1DepositorInsertIf1-Icam
UseLentiviralExpressionMammalianAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Bilbo -eCMV-CjSpD8A-3XFLAG-SV40 NLS-ITR2
Plasmid#210749PurposeCoding for CjSp D8A alongside Bilbo sgRNA targeting CAG repeatsDepositorInsertsCjSp D8A Cas9
Bilbo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD8A, N-terminal Cj Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLS.539
Plasmid#184958PurposeTest effect of a1/a2 length on editing fabH using retron recombineeringDepositorInsertEco1 RT and recombineering ncRNA, fabH G954A, a1/a2 length: 12
ExpressionBacterialMutationfabH donor G954APromoterT7/lacAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3410
Plasmid#193107PurposeMinimal promoter of NtTA29 gene containing 62bp upstream the transcription start site and the 5'UTR region (from GB1477 sequence).DepositorInsertGB_SynP minNtTA29
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.103
Plasmid#184988PurposeExpress Cas9-P2A-Eco1RTDepositorInsertCas9-P2A-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.031
Plasmid#184968PurposeTest effect of extending -Eco2 a1/a2 in yeastDepositorInsertEco2: RT and ncRNA(extended), a1/a2 length: 29
ExpressionYeastMutationhuman codon optimized RT, a1/a2 length extended t…PromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.027
Plasmid#184964PurposeExpress -Eco1 RT and ncRNA in yeastDepositorInsertEco1: RT and ncRNA(wt), a1/a2 length: 12
ExpressionYeastMutationhuman codon optimized RTPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.72
Plasmid#184984PurposeExpress Cas9/-Eco1 RT fusion, using linker1DepositorInsertCas9-fusion_linker1-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.95
Plasmid#184986PurposeExpress Cas9/-Eco1 RT fusion, using linker2DepositorInsertCas9-fusion_linker2-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.102
Plasmid#184987PurposeExpress -Eco1 RT-P2A-Cas9DepositorInsertEco1RT-P2A-Cas9
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLS.544
Plasmid#184961PurposeTest effect of a1/a2 length on editing murF using retron recombineeringDepositorInsertEco1 RT and recombineering ncRNA, murF G1359A, a1/a2 length: 22
ExpressionBacterialMutationmurF donor G1359A, a1/a2 length extended to 22 bpPromoterT7/lacAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only