We narrowed to 2,961 results for: COB;
-
Plasmid#118153PurposeSpCas9 expression vectorDepositorInserthSpCas9-T2A-HygR
UseCRISPRTags3XFLAGExpressionMammalianMutationPromoterCAG and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-M1-di-Ub(G76V)-HOIL-1
Plasmid#229539PurposeConstitutively active M1-di-ubiquitin HOIL-1 fusion protein for expression in E. coliDepositorUseTags6xHis-3CExpressionBacterialMutationChanged Gly 76 to Val and changed Gly 76 to ValPromoterT7Available SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-CBP core
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide4
Plasmid#125516PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_HA-NUP98
Plasmid#237482PurposeExpress HA-tagged NUP98 in dual promoter lentiviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-p300 core
Plasmid#179554Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide2
Plasmid#125514PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide1
Plasmid#125513PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide3
Plasmid#125515PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-124C>T_C7C_1.8kb
Plasmid#183080PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-124C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-146C>T_C7C_1.8kb
Plasmid#183081PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-146C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
Plasmid#118155PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the hPGK promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterhPGK and U6Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_C7C_1.8kb
Plasmid#183079PurposerAAV transfer plasmid with ITRs flanking: (1) TERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT wildtype promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutationWildtype promoter, Exon 1 C7C (C21>T21) silent…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 OPTN TSS-guide4
Plasmid#118199PurposeCRISPR-mediated activation of OPTN. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide1
Plasmid#118166PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZBED3-TSS-guide1
Plasmid#125506PurposeCRISPR-mediated activation of ZBED3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only