We narrowed to 2,563 results for: neurod
-
Plasmid#78038Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pTWIN1-His6-Ssp-Htt2-90-15Q-P90C
Plasmid#114611PurposeBacterial expression of Htt fragment containing amino acids 2-90, with P90C cysteine mutation and a 15 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationP90C; 23 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90(A2C)-37Q
Plasmid#114617PurposeBacterial expression of Htt fragment containing amino acids 2-90, with A2C cysteine mutation and a 37 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C; 23 polyQ repeatAvailable SinceOct. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-43Q-A2C
Plasmid#114622PurposeBacterial expression of Htt fragment containing exon 1, with A2C cysteine mutation and a 43 polyQ repeatDepositorInsertHuntingtin Exon1 (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C; 43 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-43Q-A2C-A60C
Plasmid#114623PurposeBacterial expression of Htt fragment containing exon 1, with A2C & A60C cysteine mutations and a 43 polyQ repeatDepositorInsertHuntingtin Exon1 (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C, A60C; 43 polyQ repeatAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90(A2C)-49Q
Plasmid#114627PurposeBacterial expression of Htt fragment containing amino acids 2-90, with A2C cysteine mutation and a 49 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C; 49 polyQ repeatAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90-49Q-P90C
Plasmid#114631PurposeBacterial expression of Htt fragment containing amino acids 2-90, with P90C cysteine mutation and a 49 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationP90C; 49 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAK gRNA (BRDN0001146687)
Plasmid#76470Purpose3rd generation lentiviral gRNA plasmid targeting human GAKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg2
Plasmid#244864PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 puro HTRA2 sg1
Plasmid#244863PurposeKnockout of human HTRA2DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-GRN-HA
Plasmid#243760PurposeAAV plasmid expressing human GRN with a C-terminal HA tag under the CAG promoter.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2-bGH
Plasmid#235300PurposeComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only