MLM3636-Prnp-CDS-Neg
(Plasmid
#61856)
-
PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strand
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMLM3636
-
Backbone manufacturerJoung lab MLM3636
- Backbone size w/o insert (bp) 2278
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePrP guiding sequence
-
Alt namePrPC
-
gRNA/shRNA sequenceTTGGCCCCATCCACCGCCAT
-
SpeciesM. musculus (mouse)
-
Entrez GenePrnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
- Promoter hU6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer OS280 (5’-CAGGGTTATTGTCTCATGAGCGG-3’) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original plasmid was purchased from Addgene: MLM3636.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLM3636-Prnp-CDS-Neg was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 61856 ; http://n2t.net/addgene:61856 ; RRID:Addgene_61856) -
For your References section:
CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. Mehrabian M, Brethour D, MacIsaac S, Kim JK, Gunawardana CG, Wang H, Schmitt-Ulms G. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. PONE-D-14-36316 [pii] PubMed 25490046