We narrowed to 4,774 results for: yfp
-
Plasmid#87614PurposeVenus (YFP) fused to histone H2B.DepositorAvailable SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pJ23101
Plasmid#70252PurposeExpresses YFP from J23101 promoter and CFP from standard J23101 promoterDepositorInsertpromoter J23101-RBS B0034-EYFP-B0015
Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-565-YFP-566CT
Plasmid#41677DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Synthetic, Mouse)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1-570-YFP-571CT
Plasmid#41679DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Synthetic, Mouse)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; YFP inserted d…PromoterCMVAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-BCPp-NLS-2xmCH_STR1p-cYFP-STR1g_STR2p-nYFP-STR2g
Plasmid#254407PurposeBiFC plasmid with cYFP-STR and nYFP-STR2 expressed from their native promoters and MtBCP1-NLS- 2X mCherry.DepositorInsertsSTR promoter-nYFP-STR_STR2 promoter-cYFP-STR2
M. truncatula BCP1 promoter - NLS-2X-mCherry
ExpressionPlantPromoterMtBCP1 promoter and STR promoterAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300-Aar1-BCPp-NLS-2xmCH_STR1p-nYFP-STR1g_STR2p-cYFP-STR2g
Plasmid#254408PurposeBiFC plasmid with nYFP-STR and cYFP-STR2 expressed from their native promoters and MtBCP1-NLS- 2X mCherry.DepositorInsertsStr promoter-cYFP-STR-STR2 promoter-nYFP-STR2
MtBCP1 promoter-NLS-2XmCherry
ExpressionPlantPromoterMtBCP1 and STR promoterAvailable SinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP
Plasmid#137164PurposeIntersectional viral expression of EYFP in cells expressing Cre AND Flp AND VcreDepositorHas ServiceAAV Retrograde and AAV8Insert3x-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT-DEST EVC2ala7-TEV-YFP-Flag
Plasmid#41013DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1189-1192 to AlanineAvailable SinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT-DEST EVC2ala5-TEV-YFP-Flag
Plasmid#41012DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1185-1188 to AlanineAvailable SinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT-DEST EVC2ala4-TEV-YFP-Flag
Plasmid#41011DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsTEV-YFP-FlagExpressionMammalianMutationchanged amino acids 1183-1186 to AlanineAvailable SinceNov. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Elf5-KI-3'UTR-2A-EYFP-NLS
Plasmid#128833PurposeKnock-in of nuclear EYFP into mouse Elf5 locusDepositorInsertNuclear EYFP into Elf5 locus (Elf5 Mouse)
UseMouse TargetingAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSin wPGK-Cre
Plasmid#101242Purposelow-efficiency Cre used to turn on dio YFP/ PSD95-mCherry/ Teal-gephyrin expressionDepositorInsertCre recombinase
UseLentiviralMutationsee attached fileAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-hChR2(C128A)-EYFP-WPRE
Plasmid#20293PurposeLentiviral expression of ChR2 (C128A) Step Function Opsin (SFO) fused to EYFP, for bi-stable optogenetic excitationDepositorInsertchannelrhodopsin-2
UseLentiviralTagsEYFPExpressionMammalianMutationchanged Cysteine 128 to AlanineAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
proinsulin-EYFP
Plasmid#218952PurposeExpresses proinsulin fused to EYFP in bacteriaDepositorInsertproinsulin-EYFP
TagsproinsulinExpressionBacterialPromoterT5Available SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg7_H
Plasmid#146476PurposeMammalian Expression of HsSmg7DepositorInsertHsSmg7 (SMG7 Human)
ExpressionMammalianMutationone non silent mutation G2560A (V854I) and three …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only