We narrowed to 12,388 results for: shRNA
-
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only
-
px330_SMAD exon 9 gRNA
Plasmid#68352Purposepx330 with gRNA towards SMAD exon 9. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 9 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pELF2.1.0-gDNA
Plasmid#132454PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertELF2 (ELF2 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g4 + Cas9
Plasmid#153018PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGRHL2.1.0-gDNA
Plasmid#175863PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertGRHL2 (GRHL2 Human)
UseCRISPRAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pResQ shFEN3 3XF-FEN1 D181A
Plasmid#17753DepositorInsertFlap Endonuclease I (FEN1 Human)
UseLentiviral and RNAiTagsTriple FlagExpressionMammalianMutationD181AAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12.1.0-gDNA
Plasmid#113769PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB12DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB17.1.0-gDNA
Plasmid#112483PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB17DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLX.1.0-gDNA
Plasmid#112466PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MLXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_1
Plasmid#72354PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTFCP2.1.0-gDNA
Plasmid#112404PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFCP2DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-1
Plasmid#74435PurposesgRNA expression vector for mouse Dedd gene targeting intron 5DepositorAvailable SinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#3-hygro
Plasmid#254680Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#2-hygro
Plasmid#254679Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#1-hygro
Plasmid#254678Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-ZNF865-hUbC-dCas9-KRAB-eGFP
Plasmid#241308Purpose3rd gen lenti vector encoding dCas9 (s. Pyogenes) fused with the KRAB and a 2A eGFP fluorescence marker. Includes guide for suppression of the ZNF865 geneDepositorInsertZNF865 sgRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.13
Plasmid#246892PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP2 Nterm.DepositorInsertG3BP2 Nterm Guide RNA 1 (G3BP2 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_908
Plasmid#245330PurposeCas12a CRISPRa positive control guide; targets CD274, ADGRE5, CD4, DPP4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only