We narrowed to 7,490 results for: Gca
-
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRExpressionWormAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWT055b
Plasmid#96877Purposetheophylline-agRNA-FANCFDepositorInserttheophylline-agRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g3
Plasmid#153013PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #1
Plasmid#61515Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgcggcagctcctagctcagc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Crispr-V2-HMID.v1
Plasmid#103062PurposeLentiCrisprV2 with guide targeting V1-V5 GESTALT barcodesDepositorInsertCas9 plus expressed GESTALT V1-V5 guide
UseLentiviralAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBC-G3-tdT
Plasmid#62814PurposepPBC-G3-tdT expresses PiggyBac inverted terminal repeat-flanked GCaMP3 and tdTomato under the control of the CAG promoter.DepositorInsertITR-CAG-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM1A_2
Plasmid#86298PurposeEncodes gRNA for 3' target of human KDM1ADepositorInsertgRNA against KDM1A (KDM1A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
GOLPH3 shRNA
Plasmid#163860PurposeshRNA targeting the coding sequences of GOLPH3DepositorInsertgolgi phosphoprotein 3 (GOLPH3 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_1
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFSP2
Plasmid#86134PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFSP2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only