We narrowed to 11,884 results for: CHL
-
Plasmid#235114PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP3mut3A.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pB-TetOn-DEST-EFS-mODC-rtTA-IRES-NEO (JDW 931)
Plasmid#242578PurposePiggyBac transposon flanked, Tet-on, gateway destination vector.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DV-IRES-myr-mKate (JDW 494)
Plasmid#242575PurposeGateway destination vector with a CAGGS promoter in the backbone as well as an IRES-myr-mKate to label cell membranes.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
SS-Myc-HexaPro-Foldon (MTK 3a) (pZYW077)
Plasmid#194233PurposeMammalian Toolkit part 3a encoding Jason McClellan lab's 6-proline Spike extracellular domainDepositorInsertCD8a Signal Sequence-Myc Tag-SARS-CoV-2 Spike1-1258 (S Synthetic)
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-ccdB-mRuby3
Plasmid#166142PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a 2um element for high copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
cacna2d1 R241A pMT2
Plasmid#206110Purposeexpression of rat alpha2delta-1 calcium channel auxillary subunit and with R421A mutation that disrupts Gabapentin bindingDepositorAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only