We narrowed to 2,541 results for: T2A
-
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-A
Plasmid#200824PurposeAAV transfer plasmid encoding a circularized RNA barcode A under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-B
Plasmid#200825PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-C
Plasmid#200826PurposeAAV transfer plasmid encoding a circularized RNA barcode C under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-D
Plasmid#200827PurposeAAV transfer plasmid encoding a circularized RNA barcode D under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-PuroR [M1G]
Plasmid#171801PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-PuroR [M1G]
Plasmid#171813PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_Ngn2-ISL1-LHX3_Down-Tandem
Plasmid#241396PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of Ngn2, ISL1 and LHX3DepositorTagsNLSExpressionMammalianPromoterTRE; CAGAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-BlastR [M1G]
Plasmid#171817PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-hgp100-BlastR [M1G]
Plasmid#171815PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-mgp100-PuroR [M1G]
Plasmid#171811PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-hgp100-PuroR [M1G]
Plasmid#171810PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-hgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-BlastR [M1G]
Plasmid#171808PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-BlastR [M1G]
Plasmid#171806PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-PuroR [M1G]
Plasmid#171804PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only