We narrowed to 17,288 results for: REV
-
Plasmid#253022PurposeEncodes the Suc2 signal peptide, Invertase, C-terminal GFP11-M3 and 6xHistidine tags in a yeast expression vector with pTEF1 promoter, LEU2 selectable markerDepositorInsertSuc2
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD291
Plasmid#253024PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pPGK1 promoter, tENO2 terminator, KanamycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD292
Plasmid#253025PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pPGK1 promoter, tENO2 terminator, HygromycinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD293
Plasmid#253026PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with ppPGK1 promoter, tENO2 terminator, ZeocinR yeast selectable marker and CEN/ARS yeast originDepositorInsertAGA1
ExpressionYeastAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
P1K-3HA-Atg8-MET15
Plasmid#207032PurposeExpression of 3HA-Atg8.DepositorInsertATG8
Tags3xHAExpressionYeastPromoterpATG8Available SinceJan. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
Sc mec1-S6-P/FLAG-pRS403/GAL-L
Plasmid#240737PurposeOver-express Sc mec1-S6-PreScission Protease Site-FLAG in yeast (integrated)DepositorInsertmec1-S6-P/FLAG (MEC1 Budding Yeast)
TagsS6, followed by PreScission Protease site, follow…ExpressionYeastAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_FL Gcn4
Plasmid#232955PurposeGalactose iduced expression of full-length Gcn4 in yeastDepositorInsertGcn4
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R2
Plasmid#232970PurposeGalactose iduced expression of Gcn4 R+ in yeastDepositorInsertGcn4 R+
TagsTEV cleavage siteExpressionYeastMutationK118R, K140RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 L113A+
Plasmid#231873PurposeBacterial expression of N-terminally 6His tagged Gcn4 L113A+DepositorInsertGcn4 L113A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL113A, E114Y, N126H, D127E, S136APromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only