We narrowed to 2,282 results for: mt
-
Plasmid#232498PurposeGenetic complementation plasmid of split-LetA with LetBDepositorExpressionBacterialMutation[LetA1(1-223)]-[LetA2(224-427)]PromoterT7Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pBEL2635
Plasmid#232499PurposeGenetic complementation plasmid of LetA(Δ2-17) with LetBDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEL2636
Plasmid#232500PurposeExpression plasmid of of LetA with LetB(F468B)DepositorTags6xHis2xQH-TEVExpressionBacterialMutationLetB F468AmberPromoteraraBADAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBEL2399
Plasmid#232487PurposeGenetic complementation plasmid of LetA(C31A) with LetBDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MT2A_beta-Villin
Plasmid#200301PurposeBacterial expression plasmids for production of recombinant fusion protein having beta-domain of metallothionein 2a and chicken Villin headpiece domain HP-35DepositorInsertbeta-domain of metallothionein 2a in fusion with HP-35 (MT2A Human)
TagsChiting Binding Domanin-InteinExpressionBacterialPromoterT7Available SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLRX-roGFP2 in pT3TS-Dest
Plasmid#194297PurposeIn vitro transcription of the redox sensor GLRX-roGFP2 from the T3 promoter. Parton lab clone KRKDepositorInsertGLRX-roGFP2
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACE-K2P4.1-StrepTagII
Plasmid#191474PurposeExpresses K2P4.1 with C-terminal StrepTagIIDepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfLEA1.1 (pBS0741)
Plasmid#185233PurposeFor the mammalian expression of the brine shrimp protein AfLEA1.1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfLEA1.1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_HYPDU (pBS0650)
Plasmid#185194PurposeFor the mammalian expression of the tardigrade protein CAHS1_HYPDU. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_HYPDU
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only