We narrowed to 4,413 results for: dcas9
-
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-boxB-MS2-PP7
Plasmid#75397PurposesgRNA1-boxB-MS2-PP7DepositorInsertsgRNA1-boxB-MS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-VP64-Hygro
Plasmid#104405Purposetransient expression of dCas9-VP64 fusion proteinDepositorInsertVP64
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LC-E18
Bacterial strain#115924PurposeExpression of dCas9 gene under the control of a Ptet promoter in the E. coli chromosomeDepositorBacterial resistanceNoneAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-VP64-Hygro
Plasmid#104405Purposetransient expression of dCas9-VP64 fusion proteinDepositorInsertVP64
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJT300 Lenti pEF-dCas9-3XFLAG-ZNF705_KRAB-T2A-tagBFP-P2A-Blast
Plasmid#195542PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dCas9-3XFLAG-ZNF705_KRAB-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
TET1cd-dCas9-IBM1cd (D24)
Plasmid#239490PurposeEncodes a CRISPR/dCas9-based fusion protein designed for targeted DNA demethylation.DepositorInsertRPS5A-TET1cd-XTEN80-NLS-dCas9-2xNLS-XTEN16-BFP-IBM1cd
UseCRISPRExpressionPlantAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-MS2-PP7
Plasmid#75392PurposesgRNA1-MS2-PP7DepositorInsertsgRNA1-2XMS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
(364) SB KRAB-SadCas9
Plasmid#163022PurposeSleeping Beauty TET-On expression of CRISPRi (without U6-gRNA)DepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTET-OnAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
(364) SB KRAB-SadCas9
Plasmid#163022PurposeSleeping Beauty TET-On expression of CRISPRi (without U6-gRNA)DepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTET-OnAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLH-sgRNA1-MS2-PP7
Plasmid#75392PurposesgRNA1-MS2-PP7DepositorInsertsgRNA1-2XMS2-PP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by