We narrowed to 7,330 results for: mag
-
Plasmid#239645PurposeExpression of Ribozyme split GFPuv with gq2 motifDepositorInsertGFPuvn_Y72-Ribozyme-2nd_GFPuvc+gq2
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB177
Plasmid#239651PurposeExpression vector of deactivated ribozyme with IGS2 split GFPuvDepositorInsertdRibozyme split GFPuv2_Y72_igs2
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB105
Plasmid#239639PurposeExpression vector of GFPuv with 3’ tEvopreq motifDepositorInsertGFPuv+tEvopreq
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB112
Plasmid#239648PurposeExpression vector of Ribozyme split GFPuv with Triplex motifDepositorInsertGFPuvn_Y72-Ribozyme-2nd_GFPuvc+Triplex
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB035
Plasmid#239575PurposeDeactivated ribozyme split sfGFP expressionDepositorInsertSuperfolder GFP with deactivated ribozyem insertion
UseSynthetic BiologyExpressionPlantAvailable SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB028
Plasmid#239576PurposeRibozyme split GFPuv expressionDepositorInsertGFPuv coding sequence inserted with ribozyme
UseSynthetic BiologyExpressionPlantAvailable SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB034
Plasmid#239574PurposeRibozyme split sfGFP expressionDepositorInsertSuperfolder GFP with ribozyem insertion
UseSynthetic BiologyExpressionPlantAvailable SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB031
Plasmid#239577PurposeDeactivated ribozyme split GFPuv expressionDepositorInsertGFPuv coding sequence inserted with deactivated ribozyme
UseSynthetic BiologyExpressionPlantAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD-luxNeon
Plasmid#229942PurposeBacterial expression of a de novo designed, FRET-based neoLux1.2-mNeonGreen fusion bioluminescent probe (max. Em=518nm)DepositorInsertluxNeon
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only