We narrowed to 5,646 results for: phy
-
Plasmid#244970PurposeExpress EGFP under CMV promoter. Xho I-CMVp-AgeI-EGFP.DepositorInsertCMVp-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term_aMFx1 (4a)
Plasmid#238900PurposePlasmid insert contains the aMFx1 C-terminal tag sequence for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertC-term_aMFx1
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term_aMFx1_noKREAEA (4a)
Plasmid#238901PurposePlasmid insert contains the aMFx1 noKREAEA C-terminal tag sequence for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertC-term_aMFx1_noKREAEA
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term_aMFx4 (4a)
Plasmid#238902PurposePlasmid insert contains the aMFx4 C-terminal tag sequence for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertC-term_aMFx4
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
twinStrep_FLAG_aMFx1 (4a)
Plasmid#238904PurposePlasmid insert contains the aMFx1, FLAG and twinStrep C-terminal tag sequences for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInserttwinStrep_FLAG_aMFx1
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
twinStrep_HA_aMFx1 (4a)
Plasmid#238905PurposePlasmid insert contains the aMFx1, HA and twinStrep C-terminal tag sequences for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInserttwinStrep_HA_aMFx1
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
twinStrep_aMFx1 (4a)
Plasmid#238906PurposePlasmid insert contains the aMFx1 and twinStrep C-terminal tag sequences for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInserttwinStrep_aMFx1
UseSynthetic BiologyAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVTRE3_smFP_HA
Plasmid#201209PurposeAAV vector for TRE(TRE3G)-driven smFP_HA (HA-tagged spaghetti monster) expressionDepositorInsertsmFP _HA (addgene plasmid #59759)
UseAAVExpressionBacterial and MammalianPromoterTRE3GAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR158
Plasmid#240639PurposeExpression of NLS-Kaede in Exaiptasia diaphanaDepositorInsertsAIPGENE865 promoter
Kaede
UseExpression of nls-kaede in exaiptasia diaphanaTagsSV40 NLSMutationnaturally occurring 749-bp insertion at bp 628 (f…PromoterExaiptasia diaphana Elongation Factor 1 alpha (AI…Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABCB10-eYFP
Plasmid#206038PurposeExpress YFP in mitochondriaDepositorInsertEYFP
TagsABCB10 mitochondrial leading sequenceExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS4
Plasmid#231613PurposeL-arabinose (Ara)- and anhydrotetracycline (aTc)-inducible inverter circuit reported by mKate and/or sfGFP fluorescence signalsDepositorInsertPtet-AraC-mKate2-Pbad-TetR-sfGFP
UseSynthetic BiologyExpressionBacterialPromoterPbad/PtetAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG-PIP65
Plasmid#196803PurposeContains ATG8A promoterDepositorInsertAUTOPHAGY-RELATED 8A
UseGreengate (gg) entry vectorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-PIP72
Plasmid#196810PurposeContains PMR4 promoterDepositorInsertPOWDERY MILDEW RESISTANT 4
UseGreengate (gg) entry vectorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K-TDH3pr-mNeon
Plasmid#194534PurposeLow copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K-TDH3pr-mNeon
Plasmid#194535PurposeHigh copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41N-TDH3pr-mNeon
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDH1_KW
Plasmid#224145PurposeIPTG-inducible expression of C. elegans protein MDH-1 with a chitin tagDepositorAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only