We narrowed to 5,008 results for: AAT
-
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
ipUSEPR-sg-Hs-CDK1
Plasmid#188684Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_2nd-hU6-sgNT
Plasmid#177229PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_2nd/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_1st-mU6-sgNeo1-hU6-sgNT
Plasmid#177225PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_1st/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgLkb1_1st-hU6-sgNT
Plasmid#177226PurposeExpresses Neomycin (bU6), Lkb1 (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgLkb1_1st/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgLkb1_2nd-mU6-sgNeo1-hU6-sgNT
Plasmid#177228PurposeExpresses Lkb1(bU6), neomycin (mU6) and non-targeting(hU6) gRNAs and Cre-recombinaseDepositorInsertsgLkb1_2nd/sgNeo1/sgNT1
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_APL3
Plasmid#166073PurposePlasmid for constituive spCas9 and tet-inducible APL1-targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YNR071C
Plasmid#166081PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of YNR071C for double stranded break formation in yeast.DepositorInsertPromoter of YNR071C (YNR071C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_SLA1
Plasmid#166075PurposePlasmid for constituive spCas9 and tet-inducible SLA1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA A
Plasmid#127904PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GLT-1b delta 4
Plasmid#98707Purposemammalian expression of Glt1b delta 4 mutantDepositorInsertGlt1b (Slc1a2 Rat)
ExpressionMammalianMutationmissing last 4 amino acids at the C-terminus. I52…Available SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK581
Plasmid#71695PurposeProduces Acetobacter aceti 1023 thioredoxin with a C-terminal His6 tag and Cys35>Ser mutant (AaTrxAH6-C35S)DepositorInsertthioredoxin
TagsHis6ExpressionBacterialMutationchanges cysteine-35 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK558
Plasmid#71704PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with Cys138>Ser mutant (AaTrxB1-C138S)DepositorInsertthioredoxin reductase 1
ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only