We narrowed to 3,238 results for: ER;
-
Plasmid#184556PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE
Plasmid#105322PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoter, Cre-dependent expressionDepositorHas ServiceAAV1InsertjGCaMP7c variant 1513
UseAAV and Cre/LoxTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.iGluSnFR3.v857.IgK-NGR
Plasmid#196226PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn FLEX iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6/PGKAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMWCAVI_H6BAP-OROV_N
Plasmid#240162PurposePlasmid encoding Oropouche virus (OROV) nucleoprotein (N) with an N-terminal His6 and biotin acceptor peptide (BAP, a.k.a. AviTag) for expression in E. coliDepositorInsertNucleoprotein
Tags6xHis, Biotin acceptor peptide (BAP, a.k.a. AviTa…ExpressionBacterialAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPTH OROV N
Plasmid#229663PurposeExpress Oropouche virus BeAn 19991 nucleoprotein with N-terminal His6 tagDepositorInsertNucleoprotein
Tags6xHisExpressionBacterialPromoterT7Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
Plasmid#177435PurposeTo express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.DepositorInsertPhosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA (PTDSS1 Human)
UseLentiviralTagsmCherryExpressionMammalianPromoterEF1aAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-pEGFP-C1
Plasmid#177414PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-cb5-pEGFP-C1
Plasmid#177422PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-s2193
Plasmid#177423PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pESR1.1.0-gDNA
Plasmid#112433PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ESR1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pESR1-donor
Plasmid#112337PurposeCRISPR donor plasmid to tag human transcription factor ESR1 with GFPDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-HDEL
Plasmid#129098PurposeFor labeling endoplasmic reticulum (ER) in S. cerevisiae with GFP-HDELDepositorInsertTEF1p-SS-3xGlyAla-GFP-HDEL
ExpressionYeastAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only