We narrowed to 16,638 results for: form
-
Plasmid#174501Purposebacterial co-expression of human SEPT7 and of human SEPT9_i3DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
AAV phSyn1(S)-FlpE-bGHpA
Plasmid#50364PurposeCan be used to generate AAV virus that will express FlpE recombinse gene in neurons from the synapsin promoterDepositorInsertFlpE recombinase gene
UseAAVPromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 SIRT1-deltaExon2
Plasmid#105671PurposeMammalian expression construct of mouse SIRT1 short isoform (lacking Exon2)DepositorInsertSIRT1 (Sirt1 Mouse)
ExpressionMammalianMutationSynonymous base changes not affecting the protein…PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha2
Plasmid#45502DepositorAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hPEN2 D90A
Plasmid#183641PurposeLentiviral expression of a PEN2 mutant losing its binding affinity to metformin at the C-terminus (lysosome lumen).DepositorInsertPEN2 (PSENEN Human)
UseLentiviralTagsHAMutationresidues 90 of PEN2 mutated to alaninePromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hPEN2 2A
Plasmid#183640PurposeLentiviral expression of a PEN2 mutant losing its binding affinity to metformin at the N-terminus (cytosolic face).DepositorInsertPEN2 (PSENEN Human)
UseLentiviralTagsHAMutationresidues 35 and 40 of PEN2 mutated to alaninePromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/Strep-HA-ZAK beta
Plasmid#141195PurposeExpresses Strep-HA-ZAK beta in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
Plasmid#162877PurposeExpression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALMDepositorInsertpleckstrin homology domain of PLCδ1 (phospholipase C-δ1) (PLCD1 Human)
TagsmEos2ExpressionMammalianMutationInsert consists of AA1-170Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 GBP (GBP-mEos2)
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PET.SUMO eIF4G1 1-200
Plasmid#158791PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform lacking the microexon.DepositorInserteIF4G1 (codon optimized)
Tags6xHIS and SUMOExpressionBacterialMutationamino acids 1-200PromoterT7Available SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PET.SUMO eIF4G1 +MIC 1-200
Plasmid#158792PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform including the microexon.DepositorInserteIF4G1 (with microexon) codon optimized
Tags6xHIS and SUMOExpressionBacterialMutationamino acids 1-200PromoterT7Available SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana IMPORTIN ALPHA 3 / MOS6
Plasmid#175820PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 3 / MOS6, lacks start ATG and includes stop codon for N-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 3 (MOS6 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnonePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
S4246
Bacterial Strain#156372PurposeErythromycin-resistant S2060 derivativeDepositorBacterial ResistanceStreptomycin, Tetracycline, ErythromycinAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
xPERT-hA2q
Plasmid#231063PurposeCircularly permuted CasRx platform fused to human deaminase domain for A to I editingDepositorInsertsUseCRISPRExpressionMammalianMutationH460D, E488Q, only the deaminase domain (aa 276-7…PromoterCMVAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta3-EGFP
Plasmid#160980PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta3 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta3 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-G3
Plasmid#135521PurposeEngineered form of fibroblast growth factor 2 with improved thermostabilityDepositorInsertfibroblast growth factor 2 (FGF2 Human)
Tags6x His tag and Agg Thrombin TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromoterAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only