We narrowed to 166,003 results for: addgene
-
Plasmid#228511PurposeT7 RNAP inducible Lysin KU1 ExpressionDepositorInsertLysin KU1
UseSynthetic BiologyPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaAll
Plasmid#216878PurposeDerived from the plasmid for Mega GVs, pST39-pNL29 (Addgene #91696), but all gas vesicle proteins have been deleted.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC3-C-GFP-NLS
Plasmid#222604PurposeExpression of MAC3-tagged GFP-NLS (C-terminal)DepositorInsertEGFP and 5' nuclear localizaition sequence (NLS) (PPKTTRKVED)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 6, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NES
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-NTRK3
Plasmid#222612PurposeExpression of MAC3-tagged NTRK3DepositorAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-Myr
Plasmid#222608PurposeExpression of MAC3-tagged GFP-Myr (N-terminal)DepositorInsertEGFP and 3' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-Myr
Plasmid#222605PurposeExpression of MAC3-tagged GFP-Myr (C-terminal)DepositorInsertEGFP and 5' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
hU6-DR_BsmBI_DR-EFS-RfxCas13d-NLS-2A-Puro-WPRE CasRx pre-gRNA backbone
Plasmid#219823PurposeEF1α-driven expression of RfxCas13d in mammalian cells. For cloning of pre-guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. (Adapted from plasmid #138147)DepositorInsertRfxCas13d
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core promoterAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-CFID-mCh-Cry2WT-NLS
Plasmid#221923PurposeExpression of CBP CFID fragment fused to optogenetic protein mCh-Cry2WTDepositorInsertCBP CFID (aa 1892-2441) (CREBBP Human)
UseLentiviralTagsmCherryExpressionMammalianMutationinsertion of the CBP-FUS interaction domain (CFID…Available SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-AL-mCh-Cry2WT-NLS
Plasmid#221924PurposeExpression of CBP autoregulatory loop (AL) fragment fused to optogenetic protein mCh-Cry2WTDepositorInsertCBP AL (aa 1529-1607) (CREBBP Human)
UseLentiviralTagsmCherryExpressionMammalianMutationinsertion of the autoregulatory loop (AL) (aa 152…Available SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-AP1x6-GM55
Plasmid#217416PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter, and a chromatin priming element. Alias: LEGO-GM55-AP-1x6-pDHS(IL-3)DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only