We narrowed to 3,244 results for: Streptococcus
-
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICSL11058
Plasmid#68254PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barleyDepositorInsertPromoter_TaU6 + sgRNA_HvPM19_3
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRExpressionWormPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -91
Plasmid#50923PurposeU6 driven sgRNA targeting Sox17 -91 bp from TSSDepositorAvailable sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSp218- pMEL16 + BamHI/EcoRI
Plasmid#227698PurposepMEL16 backbone + BamHI/EcoRIDepositorTypeEmpty backboneExpressionYeastAvailable sinceAug. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSUMO_EGTUCGFP
Plasmid#260353PurposeExpresses egtUCGFPDepositorInsertegtUCGFP
Tags6x HIS and SUMOExpressionBacterialPromoterT7Available sinceAug. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
OlexA_mini35S_Cas9
Plasmid#257235PurposeA cloning backbone with mCherry tagged Cas9 designed for single-guide RNA insertion and inducible knockoutDepositorInsertOlexA_mini35S_Cas9
UseCRISPRTagsmCherryPromoterOlexA_mini35SAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
sgOPTI:U6-gRNA-blastR
Plasmid#256626Purposelenti virus vector expressing a Cas9 guide RNA under a human U6 promoter. Contains blast resistance cassette.DepositorInsertsgRNA
UseLentiviralPromoterU6 promoterAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPHYCUT
Plasmid#255426PurposeExpresses codon-optimized versions of SpCas9 and Csy4, with a U6 promoter-driven BsaI cloning casette for the expression of multiple sgRNAs in Phaeodactylum tricornutum.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Episomal vector for…Available sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Srs2-C-terminus_pET28a
Plasmid#247774PurposeThe primary use of this plasmid is as a target for CRISPR-Cas9. It can also be used to express the His-tagged C-terminus of Srs2 with Lys-to-Arg mutations.DepositorInsertSrs2-C-terminus (NEWENTRY Budding Yeast)
MutationThe C-terminus of the gene has Lys-to-Arg mutatio…PromoterT7Available sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAPIC-soma-AcrIIA4
Plasmid#250802PurposeDrosophila transgenic vector: To make tub-AcrIIA4 with piRNA targeting sequence in the 3'UTR; to suppress Cas9 activity in somatic tissues but not in the germlineDepositorPublicationInsertAcrIIA4
ExpressionInsectAvailable sinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APIC-AcrIIA4
Plasmid#250800PurposeDrosophila transgenic vector: Gateway cloning destination vector for expressing enhancer driven AcrIIA4DepositorPublicationTypeEmpty backboneExpressionInsectAvailable sinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Phleo
Plasmid#236780PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable sinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
AcrIIA5-E76-LOV-C450A-K488N(M478)
Plasmid#250778PurposeExpresses AcrIIA5-E76-AsLOV2 with C450A and K488N mutation from a CMV promoter. For use in mammalian cellsDepositorInsertAcrIIA5 with an AsLOV2 insertion behind E76 and C450A and K488N mutation
UseCRISPRExpressionMammalianMutationC450A, K488NAvailable sinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-dCas9-3XmCherry-CRY2
Plasmid#249580PurposeLentiviral vector for stable expression of dCas9-3XmCherry-CRY2hiclu fusion protein in mammalian cellsDepositorInsertsCRY2hiclu
Sp dCas9
UseLentiviralTags3XmCherryExpressionMammalianMutationCatalytically dead mutant Cas9PromoterCMVAvailable sinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-His6-TEV-SpyCatcher003-cys
Plasmid#249543PurposeExpresses SpyCatcher003 with a N-terminal 6x-His tag and a C-terminal cysteine in E.coli under the T7 promoterDepositorPublicationInsertSpyCatcher003-cys
Tags6x His and CysteineExpressionBacterialPromoterT7Available sinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-dCas9-3XGFP-CIBN
Plasmid#249581PurposeLentiviral vector for stable expression of dCas9-3XGFP-CIBN fusion protein in mammalian cellsDepositorInsertsUseLentiviralTags3XsfGFPExpressionMammalianMutationCatalytically dead mutant Cas9 and N-terminal por…PromoterCMVAvailable sinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only