We narrowed to 45,585 results for: CAT
-
Plasmid#33382DepositorInsertZinc finger array targeting atp2c1 (atp2c1 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
col6a2_R (OZ594)
Plasmid#35234DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
col6a2_L (OZ593)
Plasmid#35233DepositorInsertZinc finger array targeting col6a2 (col6a2 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
flt1_L (OZ585)
Plasmid#35225DepositorInsertZinc finger array targeting flt1 (flt1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
flt1_R (OZ586)
Plasmid#35226DepositorInsertZinc finger array targeting flt1 (flt1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
hnf1a_R (OZ522)
Plasmid#27197DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
hnf1a_L (OZ521)
Plasmid#27196DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_L (OZ537)
Plasmid#27214DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_R (OZ538)
Plasmid#27215DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_L (OZ551)
Plasmid#28076DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_R (OZ552)
Plasmid#28077DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_L (OZ531)
Plasmid#27208DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_R (OZ532)
Plasmid#27209DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgMST1/2-2
Plasmid#229430Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
VC-Y705F+K49R-STAT3
Plasmid#203721PurposeExpresses the PTM-resistant, double mutant Y705F+K49R - STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with VC (aa 158-238) (STAT3 Human)
TagsVC (aa 158-238) for bimolecular fluorescence comp…ExpressionMammalianMutationY705F+K49R substitutionsPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
VC-Y705F+K685R-STAT3
Plasmid#203722PurposeExpresses the PTM-resistant, double mutant Y705F+K685R - STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with VC (aa 158-238) (STAT3 Human)
TagsVC (aa 158-238) for bimolecular fluorescence comp…ExpressionMammalianMutationY705F+K685R substitutionsPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_L (OZ571)
Plasmid#35211DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only