We narrowed to 7,725 results for: pcr
-
Plasmid#212765PurposeN-terminal PCR-based tagging with pCUP1-CUbo(K48R/K63R) in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pUra3-pCUP1-CUbo(K63R)
Plasmid#212764PurposeN-terminal PCR-based tagging with pCUP1-CUbo(K63R) in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUra3-pCUP1-CUbo(K48R)
Plasmid#212763PurposeN-terminal PCR-based tagging with pCUP1-CUbo(K48R) in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUra3-pCUP1-CUbo
Plasmid#212762PurposeN-terminal PCR-based tagging with pCUP1-CUbo in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUra3-pCUP1-His7-NUbo
Plasmid#212761PurposeN-terminal PCR-based tagging with pCUP1-His7-NUbo in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUra3-pCUP1-NUbo
Plasmid#212760PurposeN-terminal PCR-based tagging with pCUP1-NUbo in budding yeast with URA3 selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.3
Plasmid#112810PurposePCR template vector for amplifying gRNAcore-pU6.2 promoter fragmentDepositorInsertU6:3-gRNAcore
ExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRi-v2, Kinases, Phosphatases, and Drug Targets (m1), top 5 sgRNAs/gene
Pooled library#83989PurposeMouse CRISPRi Pooled Library tartgeting kinsases, phosphatases and Drug TargetsDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTGC-U6.2
Plasmid#112809PurposePCR template vector for amplifying gRNAcore-pU6.3 promoter fragmentDepositorInsertU6:2-gRNAcore
ExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCG 306
Plasmid#131167PurposePCR template for genomic C-terminal Cub-R-URA3 tag, URA3 complements the uracil auxotrophy of S. cerevisiae ura mutantDepositorTypeEmpty backboneTagsCCGExpressionYeastAvailable sinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1927
Plasmid#163093PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRa-v2, Gene Expression (m5), top 5 sgRNAs/gene
Pooled library#84002PurposeMouse CRISPRa Pooled Library targeting gene expressionDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJL258
Plasmid#243697PurposeA piggyBac vector containing the endogenous NDUFB9 genomic locus, with its native 5' UTR replaced by the Actb 5' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertNDUFB9 genomic locus, with its 5' UTR replaced by the ACTB 5' UTR (NDUFB9 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL259
Plasmid#243698PurposeA piggyBac vector containing the endogenous NDUFB9 genomic locus, with its native 3' UTR replaced by the Actb 3' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertNDUFB9 genomic locus, with its 3' UTR replaced by the ACTB 3' UTR (NDUFB9 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL354
Plasmid#243709PurposeA piggyBac vector containing the endogenous COX7A2 genomic locus, with its native 5' UTR replaced by the Actb 5' UTR, modified with silent mutations to allow for PCR-based analysisDepositorInsertCOX7A2 genomic locus, with its 5' UTR replaced by the ACTB 5' UTR (COX7A2 Human)
ExpressionMammalianAvailable sinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTE5423_p3WJdB-glcO60
Plasmid#221194PurposeDNA template of GlcR sensor with glcO60 operator: T7 promoter-glcO60-3WJdB reporter-T7 terminator linear DNA template (PCR amplified with oSB0021+22) is used in the IVT sensor systemDepositorInsertT7 promoter-glcO60-3WJdB
UseSynthetic BiologyExpressionBacterialPromoterT7 promoter with downstream glcO60 operatorAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHyg-CUbo(K48R/K63R)-yeGFP-His6
Plasmid#212785PurposeC-terminal PCR-based tagging with CUbo(K48R/K63R)-yeGFP-His6 in budding yeast with HygR selectionDepositorTypeEmpty backboneUsePcr-based taggingAvailable sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAct-GST-H3
Plasmid#182842PurposeA PCR product encoding GST-H3 (Drosophila histone H3) was was inserted into a modified pAct-5c vector by Sac I and Sal I sites. Expression in S2 cells.DepositorInsertGST-histone H3 fusion
TagsGSTExpressionInsectPromoterActin5CAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only