We narrowed to 9,210 results for: set
-
Plasmid#104518PurposeLI Gateway cassetteDepositorInsertGateway cassette
UseCloning vectorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjVASA-tdTomato
Plasmid#160872PurposeMarmoset TargetingDepositorInserttdTomato
UseMarmoset targetingAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjOCT4-Cyan-pac
Plasmid#160871PurposeMarmoset TargetingDepositorInsertmCerulean3
UseMarmoset targetingAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL5618_pUG_MtxR
Plasmid#60929PurposePCR template vector for generating methotrexate resistance cassette.DepositorInsertDihydrofolate reductase (DHFR Human)
UseLoxp flanked deletion cassette templateMutationL22F F31SPromoterTEF1Available SinceFeb. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFNC-8
Plasmid#227670PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. AmR, easily curable via sucrose counterselection.DepositorInsertAmR
ExpressionBacterialAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
BLADE
Plasmid#134912PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades systemDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW107
Plasmid#232796PurposeCOMPASS Fragment 2 (His-FLAG-ySet1, Cps30, Twinstrep-Cps40) in pBIG2abDepositorTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationySet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only