We narrowed to 10,670 results for: nar
-
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)PromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1_CD
Plasmid#83570PurposeExpresses the catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deletedPromoterCMVAvailable sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1 Clover-LMNA Donor
Plasmid#122508PurposeHomology repair template for in frame (first exon) clover knock-in of human LMNA geneDepositorInsertHomology Repair Template for Human LMNA (N-Terminal Clover Tag) (LMNA Human)
UseHomology repair template plasmid (donor plasmid)TagsCloverExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralTagsExpressionMutationPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRY-Gal∆DD (B1013)
Plasmid#92035PurposeExpresses CRY2 (full-length, with endogenous NLS) fused to Gal4 (aa1-65 of Gal4BD), downstream of mCherry-IRESDepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationFusion of plant CRY2 to Gal4 binding domain (AA1-…PromoterAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-2C-NLS in pCSDest
Plasmid#126638PurposeExpresses LbCas12a-2C-NLS in mammalian cellDepositorInsertLbCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianMutationPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-ABE8e
Plasmid#206882PurposeExpresses FLAG-tagged ABE8e fused to Gag through a linker sequenceDepositorInsertABE8e
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorInsertCIB1-VP64 (CIB1 Mustard Weed)
UseTagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorInsertPEMax Delta RNAseH
UseTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
A3Ai-Cas9n-UGI-NLS
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
UseTagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…PromoterAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-GST-eIF4E K119A
Plasmid#112818PurposeExpresses N-terminally GST-tagged mouse Eif4e K119A in bacterial cellsDepositorInsertEif4e (Eif4e Mouse)
UseTagsGSTExpressionBacterialMutationK119 mutated to A, increasing affinity for cap st…PromoterT7Available sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1_CD
Plasmid#83571PurposeExpresses a mutant catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deleted, catalytic domain…PromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBlue-ACTB-IR-IRES-Puro-pEF1α-EGFP-IR-ACTB
Plasmid#169921PurposeDNA donor plasmid for site-specific integration of IRES-Puro-pEF1a-EGFP cassette at the ACTB locus using Cas9-transposase fusion proteins.DepositorInsertIRES-Puro-pEF1a-EGFP
UseCRISPRTagsExpressionMutationPromoterEF1aAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only