We narrowed to 27,367 results for: STI
-
Plasmid#163604PurposeExpresses constitutively active cofilin in mammalian cellsDepositorInsertcofilin1 (Cfl1 Mouse)
ExpressionMammalianMutationS3A substitution to make cofilin constitutively a…Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD2KN0908
Plasmid#177088PurposeMoClo Level 2 plasmid containing multiple transcriptional units for transient expression of P19 (cytosol, driven by nosP), along with CrDXS2, PaGPPS1, and CrGES (plastid, driven by 4x opaatB)DepositorInsertP19, CrDXS2, PaGPPS1, and CrGES
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-83:EZH2-mEGFP
Plasmid#164499PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human EZH2DepositorInsertEZH2 Homology Arms with mEGFP-linker (EZH2 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceFeb. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
L2-AA007
Plasmid#185750PurposeVector to introduce HygR and eGFP under control of p35S into the genome of the hornwort Anthoceros agrestis via Agrobacterium mediated transformation. eGFP contains a cell membrane localization tag.DepositorInsertsHygR2
eGFP
Tagsmembrane localization tag Lti6bExpressionPlantAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS SK mCherryROSAbsr
Plasmid#54321PurposeEncodes mCherry fused with out-of-frame blasticidin-S resistance gene with a linker containing a target for TALEN/CRISPR. Can use as a surrogate target to select cells expressing active TALEN/CRISPR.DepositorInsertmCherry and BlasticidinS-resistance
UseCRISPR, Mouse Targeting, and TALENExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
bPAC-mycHis_pGEM
Plasmid#85468PurposeExpression of photoactivated cyclase bPAC of Beggiatoa sp.DepositorInsertBacterial Photoactivated Adenylyl Cyclase
TagsHis and MycPromoterT7 promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO h-PKD1 FLS (4107-4303)-GST
Plasmid#83456PurposeHuman PC1-CTp30 expression cassette with a GST-tag (678)DepositorAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIND-CLucZ
Plasmid#53224PurposeInducible expression of Cypridina luciferase and shRNAmir of interestDepositorInsertsCypridina luciferase
non-silencing shRNA
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MTK0_047
Plasmid#123977PurposeEncodes the Cas9 hCLYBL homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthCLYBL CAS9 Destination - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 1-332
Plasmid#11631DepositorAvailable SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)-SUMO-A'-l4-G'
Plasmid#209124PurposeBacterial expression of CC-GEMS ligand SUMO-A'-l4-G'DepositorInsertSUMO-A'-l4-G'
ExpressionBacterialAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BD-cop1at(335-675)
Plasmid#44973DepositorInsertBD-COP1 (COP1 Mustard Weed)
TagsGAL4 DNA-binding domainExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMVAvailable SinceJune 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
MTK0_017
Plasmid#123932PurposeEncodes the BxBI attB GFP dropout destination vector constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertBxBI attB tagBFP destination vector
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
p6903 PHAGE-B CMV-N-EGFP Myc
Plasmid#37608DepositorAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Tol2pA2-drl:APEX2-mCherry
Plasmid#188945PurposePlasmid for Tol2 transgenesis expressing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherry, driven by the draculin promoterDepositorInsertdrl:mito-APEX2_p2A_APEX2-H2B_p2A_mCherry_polyA
UseTol2 destination vector (attr4-r3)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_015
Plasmid#123930PurposeEncodes the piggyBac GFP dropout destination vector with the 2xHS4 insulator and constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertPB Destination - Insulator + tagBFP
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F0
Plasmid#184162PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS::PTPRFb-DN-GFP
Plasmid#37111DepositorInsertUAS::PTPRFb-DN-GFP (ptprfb Zebrafish)
UseTol2 gateway expression vectorTagsEGFPMutationDeleted aa1386-1909 corresponding to phosphatase …Promoter10xUASAvailable SinceJuly 18, 2012AvailabilityAcademic Institutions and Nonprofits only