We narrowed to 3,474 results for: biorxiv
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-TSF-ULK1-ADA
Plasmid#249534PurposeExpressing human full length ULK1 with P433A/V434D/P435A mutationsDepositorInsertULK1 (ULK1 Human)
TagsFlag-tag and strep-tagExpressionMammalianMutationP433A, V434D and P435APromoterCAGAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-1-835-mcherry
Plasmid#249729PurposeExpressing human ULK1-1-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-1-290-mcherrry
Plasmid#249732PurposeExpressing human ULK1-1-290 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-290-835-mcherry
Plasmid#249733PurposeExpressing human ULK1-290-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-ATG13-1-230
Plasmid#250343PurposeExpressing human ATG13 (aa. 1-230)DepositorInsertATG13 (ATG13 Human)
TagsGFPExpressionMammalianMutationonly amino acids 1-230PromoterCAGAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-ATG13-1-230(HF|DD)
Plasmid#250344PurposeExpressing human ATG13 (1-230) with H214D/F215D mutationsDepositorInsertATG13 (ATG13 Human)
TagsGFPExpressionMammalianMutationonly amino acids 1-230 with H214D and F215D muta…PromoterCAGAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGenLenti murine CD300LF
Plasmid#235668Purpose3rd Generation lentiviral vector for expression of murine CD300LF. Murine CD300LF is the receptor for murine norovirus, and expression confers susceptibility to this virus. Puromycin resistance.DepositorAvailable SinceMarch 24, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPig-hEF1a-Cry2PHR-LRP6c-Puro-Blind
Plasmid#249712PurposeExpresses optogenetic LRP6 in mammalian cells; no fluorescent proteins. Plasmid contains a puromycin selection marker.DepositorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
Plasmid#218776PurposeExpresses dCAS9-DNMT3A-DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3A (dCas9-3A-3A)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-DNMT3A-KRAB (dCas9-3A-KRAB)
Plasmid#218781PurposeExpresses dCAS9-DNMT3A-KRAB fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-DNMT3A-DNMT3L (dCas9-3A-3L)
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
M3-dCAS9-mutDNMT3A(R882H)(dCas9-mut3A)
Plasmid#218788PurposeExpresses dCAS9- R882H Mutated DNMT3A fusion protein and double marker GFP-T2A-Puro under independent promotersDepositorInsertsM3-dCAS9-MutDNMT3A (dCas9-Mut3A (R882H))
GFP-T2A-Puro
UseCRISPRExpressionMammalianAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet:KASH-6xMBS
Plasmid#231011PurposeCVS N2c RVdG genome plasmid. Utilizes MS2 tagging to deliver the MCP:oScarlet:KASH transcript to the outer nuclear membrane. Insert high complexity barcode between SacII RE sites distal to 6xMBS site.DepositorInsertMCP-oScarlet-KASH-6xMBS-SacIIMCS
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDKL5(isoform-2)
Plasmid#245901PurposeMammalian expression of CDKL5 isoform2 (1-1030) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-CDKL5(kinase)
Plasmid#245902PurposeMammalian expression of CDKL5 kinase domain (1-311) with N-terminal GFPDepositorAvailable SinceNov. 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PLCe EF-C
Plasmid#244968PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (EF hands 1/2- Cterminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-103…PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Eco2
Plasmid#240681PurposeRSF1010 origin of replication plasmid containing Eco2 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertEco2 RT, Eco2 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eco1
Plasmid#240705PurposepLAM12 vector backbone containing Eco1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEco1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only