We narrowed to 3,474 results for: biorxiv
-
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Eco2
Plasmid#240706PurposepLAM12 vector backbone containing Eco2 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertEco2 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECBRR1-Kva1
Plasmid#240703Purposeinverted BRR1 origin of replication plasmid containing Kva1 recombitron with a donor in the ncRNA to target phzM locus in Pseudomonas aeruginosa PAO1 expressed by Pm promoterDepositorInsertKva1 RT,Kva1 ncRNA, PaRecT and PaSSB
ExpressionBacterialMutationInverted BRR1 origin of replicationAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010lac-Eco1
Plasmid#240691PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by lac promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010C-Eco1
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Kva1
Plasmid#240684PurposeRSF1010 origin of replication plasmid containing Kva1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertKva1 RT,Kva1 ncRNA, Beta and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Tsp1
Plasmid#240712PurposepLAM12 vector backbone containing Tsp1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertTsp11 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Kva1
Plasmid#240709PurposepLAM12 vector backbone containing Kva1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertKva1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRECMYC-Hcl1
Plasmid#240714PurposepLAM12 vector backbone containing Hcl1 recombitron with MspRecT and a donor in the ncRNA to target MSMEG_5894 gene of Mycobacterium smegmatis mc2 155DepositorInsertHcl1 RT, Eco1 ncRNA, MspRecT
ExpressionBacterialMutationWTAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only