We narrowed to 9,148 results for: sgRNA
-
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRN1120
Plasmid#101750PurposeMulti-copy (2 micron) yeast plasmid containing a functional NatMX marker cassette conferring resistance against nourseothricin. Recipient plasmid for sgRNA or crRNA expression cassettes.DepositorTypeEmpty backboneExpressionYeastAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0751
Plasmid#185628PurposeModified tobacco rattle virus RNA2 acceptor vector that could be used for expression of sgRNAs, contains restriction enzyme sites for golden gate assembly using BsaIDepositorInsertlacZ
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-sgCDKN1B#2 BFP
Plasmid#60905PurposeA lentiviral plasmid that encodes both a sgRNA targeting CDKN1B and BFPDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCF826-recipient_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211688PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and guide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Puro
Plasmid#125594PurposeLentiviral expression of sgRNA with GFP and puromycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC155-pCR8-sgExpression
Plasmid#49045PurposeU6-driven sgRNA expressing cassette on a gateway donor vectorDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-NG-esgRNA
Plasmid#138136PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-NG-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRB17
Plasmid#52527Purposeserves as template for PCR-mediated fusion of U6-promoter with sgRNADepositorInsertDrosophila U6C promoter
UseCRISPR; Blunt cloning kitTagsT7-promoterExpressionInsectAvailable SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDD143
Plasmid#119880PurposeArabinose inducible dCas9sth1 and constitutive sgRNA on pAL5000/pMB1 backbone with gentamicin resistance.DepositorInsertpBAD_dCas9sth1
ExpressionBacterialAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CjCas9-eGFP-HIF1a
Plasmid#137929PurposeExpression of cjCas9 with Hif1a targeting sgRNADepositorInsertCjCas9
UseAAV and CRISPRTagsSV40NLS-HA-T2A-EGFPPromoterEF-1alphaAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC153-dual-dCas9VP96-sgExpression
Plasmid#48239PurposeDual expression construct expressing both dCas9VP96 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP96ExpressionMammalianMutationD10A H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
IR InterIR gRNA #5
Plasmid#247547Purposenegative control for Crispri KDDepositorInsertnegative control sgRNA targeting region between inverted repeats of Distal Junction
UseCRISPRExpressionMammalianMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
InterIR gRNA #2
Plasmid#247546Purposenegative control for Crispri KDDepositorInsertnegative control sgRNA targeting region between inverted repeats of Distal Junction
UseCRISPRExpressionMammalianMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only