We narrowed to 40,760 results for: LAT
-
Plasmid#182712PurposeaTc inducible dCasRx-IF1DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 1ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
2Bc-T MBP_BoMoC(ed)_W403A_6xH
Plasmid#185712PurposeRecombinant B. mori truncated R2 RT expressionDepositorInsertB. mori truncated R2 RT
Tags6xHis and MBPExpressionBacterialMutationChanged W403 to APromoterT7Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-miRFP670-eDHFR(69K6)
Plasmid#178852PurposeMammalian expression of miRFP670-eDHFR(69K6)DepositorInsertmiRFP670-eDHFR(69K6)
UseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-mNG-eDHFR(69K6)
Plasmid#178853PurposeMammalian expression of mNeonGreen-eDHFR(69K6)DepositorInsertmNeonGreen-eDHFR(69K6)
UseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-eDHFR(69K6)-iRFP713
Plasmid#178855PurposeMammalian expression of eDHFR(69K6)-iRFP713DepositorInserteDHFR(69K6)-iRFP713
ExpressionMammalianPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-miRFP670-eDHFR(69K6)
Plasmid#178859PurposeMammalian expression of miRFP670-eDHFR(69K6)DepositorInsertmiRFP670-eDHFR(69K6)
ExpressionMammalianPromoterCMVAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-Dm4E-T-L36AL39A_T
Plasmid#147604PurposeInsect Expression of Dm4E-T-L36AL39ADepositorInsertDm4E-T-L36AL39A (4E-T Fly)
ExpressionInsectMutationTwo non silent mutations (H628R and N659S) compar…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCup-Y342AL347A_O
Plasmid#147103PurposeInsect Expression of DmCup-Y342AL347ADepositorAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-UTX(420-633)-H6
Plasmid#183773PurposeExpress pET-UTX(420-633)-H6 in E.coli. Purified pET-UTX(420-633)-H6 was used for generating antibodies in rabbits.DepositorInsertUTX
Tags6 His tag at the C-terminusExpressionBacterialPromoterT7Available SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-Dm4E-T_1-510-Y10AL15A-V5His6_D
Plasmid#146152PurposeInsect Expression of Dm4E-T_1-510-Y10AL15ADepositorInsertDm4E-T_1-510-Y10AL15A (4E-T Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG.Lantern-INS-SM50-GFP
Plasmid#135594PurposePropogation of Insulator-SM50 Promoter-GFP DNA for microinjection to visualize Insulator-GFP promoter activity in S. purpuratusDepositorInsertINS-SM50 promoter (SM50 )
UseIn vitro transcription (mrna synthesis)TagsGreen Lantern GFPPromoterCMVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPPC018.AAV
Plasmid#171146PurposeExpression of J1-BBa_J23117-mRFP and hAAVS1 scRNA on pRK2-GmR plasmidDepositorInsertshAAVS1 scRNA
J1-BBa_J23117-mRFP
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J1-BBa_J23117Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC030.306
Plasmid#171151PurposeMevalonate production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mvaES
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14A)-mVenus
Plasmid#168499PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9R)-mVenus
Plasmid#168498PurposeMammalian expression of the K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K8,9R mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN(K8,9A)-mPAGFP
Plasmid#168494PurposeMammalian expression of the K8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.DepositorInsertK8,9A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (E12,14K)-mVenus
Plasmid#168488PurposeMammalian expression of the E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14K mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K8,9E)-mVenus
Plasmid#168487PurposeMammalian expression of the E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe E12,14A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K22,24A)-mVenus
Plasmid#168484PurposeMammalian expression of the K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K22,24A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only