We narrowed to 17,478 results for: igh
-
Plasmid#207372PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-HeFSpCas9-A1060R
UseCRISPRTags3xFLAGExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, amino …PromoterCBhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9-A1003K
Plasmid#207371PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-HeFSpCas9-A1003K
UseCRISPRTags3xFLAGExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060A, amino …PromoterCBhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9-A848K
Plasmid#207369PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-HeFSpCas9-A848K
UseCRISPRTags3xFLAGExpressionMammalianMutationN497A, R661A, Q695A, Q926A, K1003A, R1060A, amino…PromoterCBhAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9-A661R
Plasmid#207367PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-HeFSpCas9-A661R
UseCRISPRTags3xFLAGExpressionMammalianMutationN497A, Q695A, K848A, Q926A, K1003A, R1060A, amino…PromoterCBhAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9-Q661R
Plasmid#207366PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-evoSpCas9-Q661R
UseCRISPRTags3xFLAGExpressionMammalianMutationM495V, Y515N, K526E, amino acids 1005-1013 replac…PromoterCBhAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9-N515Y
Plasmid#207364PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-evoSpCas9-N515Y
UseCRISPRTags3xFLAGExpressionMammalianMutationM495V, K526E, R661Q, amino acids 1005-1013 replac…PromoterCBhAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PET-B-HeFSpCas9-NLS-6xHis
Plasmid#207392PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertB-HeFSpCas9
UseCRISPRTags6xHisExpressionBacterialMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A…PromoterT7Available SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6GB1tev-IntC-P53(304-393)
Plasmid#200315Purposebacterial expression of P53 TETCTD for segmental labelingDepositorInsertp53 (304-393) (TP53 Human)
TagsHis6GB1tev and designed intein CExpressionBacterialPromoterT7Available SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-MAVS-mTA6
Plasmid#171004PurposeHiLITR protease with MAVS [Y536delinsFIVLI, R537A, R538A] C-terminal tmd targeting information (Mitochondria)DepositorInsertEGFP-uTEV1-MAVS(tmd)[Y536delinsFIVLI, R537A, R538A]
UseLentiviral and Synthetic BiologyExpressionMammalianMutationMAVS(tmd)[Y536delinsFIVLI, R537A, R538A]PromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
TagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
C21-bio-His
Plasmid#53405PurposeExpresses full-length ES1 protein homolog precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertC21 (GATD3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
HINT2-bio-His
Plasmid#53406PurposeExpresses full-length Histidine triad nucleotide-binding protein 2 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertHINT2 (HINT2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CD84-bio-His
Plasmid#51649PurposeExpresses full-length SLAM family member 5 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertCD84 (CD84 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
ACVR1-bio-His
Plasmid#51623PurposeExpresses full-length Activin receptor type-1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertACVR1 (ACVR1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Yeast GoldenBraid Cloning System and Toolkit
Plasmid Kit#1000000138PurposeModular cloning system for generation of high expression transcriptional units; Integrates in yeast (S. cerevisiae) genome at two different loci supporting high and stable transgene expressionDepositorAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE (AAV1)
Viral Prep#105322-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE (#105322). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7c variant 1513-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7c expression. jGCaMP7c exhibits high contrast between peak fluorescence and resting fluorescence. It is useful for activity imaging of large populations of densely-labeled neurons because background fluorescence from inactive neurons is reduced. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (AAV Retrograde)
Viral Prep#104493-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b expression exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7c variant 1513-WPRE (AAV1)
Viral Prep#105321-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7c variant 1513-WPRE (#105321). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7c variant 1513-WPRE plasmid DNA. Synapsin-driven jGCaMP7c expression. jGCaMP7c exhibits high contrast between peak fluorescence and resting fluorescence. It is useful for activity imaging of large populations of densely-labeled neurons because background fluorescence from inactive neurons is reduced. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
GP1BBm-bio-His
Plasmid#52314PurposeExpresses full-length Platelet glycoprotein Ib beta chain precursor monomer ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertGP1BBm (GP1BB Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only