We narrowed to 3,976 results for: atr;
-
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pOTC-GFP
Plasmid#205724PurposeExpression of GFP fused with pOTC, a leader peptide from mitochondrial matrix enzyme ornithine transcarbamylaseDepositorInsertpOTC-GFP
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-BMPR2a
Plasmid#207616PurposeZebrafish BMPR2a BMP receptor kinase domain and CTD fused to VfLOVDepositorInsertBMPR2a kinase domain and CTD + VfLOV domain (bmpr2a Vaucheria frigida, Zebrafish)
Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-W279A-short-UBASH3A-Ctag
Plasmid#195402PurposeHuman W279A short-form UBASH3A in Gateway pDONR221 (for C-terminal tag)DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-K202R-short-UBASH3A-Ctag
Plasmid#195399PurposeHuman K202R short-form UBASH3A in Gateway pDONR221 (for C-terminal tag)DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat_500-968-dsRNAres_J
Plasmid#146693PurposeInsect Expression of DmHPat_500-968-dsRNAresDepositorInsertDmHPat_500-968-dsRNAres (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat_500-684_H
Plasmid#146470PurposeInsect Expression of DmHPat_500-684DepositorInsertDmHPat_500-684 (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat_685-968_H
Plasmid#146471PurposeInsect Expression of DmHPat_685-968DepositorInsertDmHPat_685-968 (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat-del57-499_H
Plasmid#146472PurposeInsect Expression of DmHPat-del57-499DepositorInsertDmHPat-del57-499 (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
K202R-short-UBASH3A-V5-6xHis
Plasmid#195406PurposeMammalian expression of human K202R short-form UBASH3A with V5-6xHis tagDepositorAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
W279A-short-UBASH3A-V5-6xHis
Plasmid#195409PurposeMammalian expression of human W279A short-form UBASH3A with V5-6xHis tagDepositorAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
V5-K202R-short-UBASH3A
Plasmid#192084PurposeMammalian expression of human K202R short-form UBASH3A with V5 tagDepositorAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-W279A-short-UBASH3A-Ntag
Plasmid#192096PurposeHuman W279A short-form UBASH3A in Gateway pDONR221 (for N-terminal tag)DepositorAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-K202R-short-UBASH3A-Ntag
Plasmid#192094PurposeHuman K202R short-form UBASH3A in Gateway pDONR221 (for N-terminal tag)DepositorAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-WT-short-UBASH3A-Ctag
Plasmid#192099PurposeHuman wild-type short-form UBASH3A in Gateway pDONR221 (for C-terminal tag)DepositorInsertUBASH3A (UBASH3A Human)
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-WT-short-UBASH3A-Ntag
Plasmid#192100PurposeHuman wild-type short-form UBASH3A in Gateway pDONR221 (for N-terminal tag)DepositorInsertUBASH3A (UBASH3A Human)
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe3-RfA-HA
Plasmid#186374PurposeDestination vector for the expression of a fusion of an N-ter protein of interest with an HA tag into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Spe3-HA-RfA
Plasmid#186373PurposeDestination vector for the expression of a fusion of N-ter HA tag and a protein of interest into embryos, by mRNA microinjectionDepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only